View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4060_low_31 (Length: 216)

Name: NF4060_low_31
Description: NF4060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4060_low_31
NF4060_low_31
[»] chr8 (1 HSPs)
chr8 (16-193)||(26948718-26948895)
[»] scaffold0543 (1 HSPs)
scaffold0543 (75-193)||(2637-2755)
[»] scaffold0492 (1 HSPs)
scaffold0492 (75-193)||(4183-4301)
[»] scaffold1630 (1 HSPs)
scaffold1630 (36-193)||(813-970)


Alignment Details
Target: chr8 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 26948895 - 26948718
Alignment:
16 atgaaaacttacggggatagtattctcgacaaaagaattgttgaggaaattcgaatttatattcctcgtagatatgatgcaattgttaccacgattgtgc 115  Q
    |||||||| ||| |||||| ||||||||||||||||||||||||| |||||| ||||| |||||||||||  ||||||||||||||||| ||||||| ||    
26948895 atgaaaacatacagggataatattctcgacaaaagaattgttgagaaaattctaatttctattcctcgtaagtatgatgcaattgttactacgattgagc 26948796  T
116 aaaccaaatatttgtctactttgtcagtgacagaattaataggctcactagaagcttatgagcaaatattgagtaggc 193  Q
    |||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||    
26948795 aaaccaaagatctgtctactttgttagtgacagaattaataggctcactagaagcttatgagcaaagattgagtaggc 26948718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0543 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0543
Description:

Target: scaffold0543; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 75 - 193
Target Start/End: Original strand, 2637 - 2755
Alignment:
75 tattcctcgtagatatgatgcaattgttaccacgattgtgcaaaccaaatatttgtctactttgtcagtgacagaattaataggctcactagaagcttat 174  Q
    |||||||| ||  ||||||||||||||| | || |||| || |||| || ||||||||||||||||||||||| |||||||||||||| |||||||||||    
2637 tattcctcataagtatgatgcaattgttgctacaattgagccaaccgaagatttgtctactttgtcagtgacataattaataggctcattagaagcttat 2736  T
175 gagcaaatattgagtaggc 193  Q
    ||| |||||||||||||||    
2737 gagaaaatattgagtaggc 2755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0492 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: scaffold0492
Description:

Target: scaffold0492; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 75 - 193
Target Start/End: Original strand, 4183 - 4301
Alignment:
75 tattcctcgtagatatgatgcaattgttaccacgattgtgcaaaccaaatatttgtctactttgtcagtgacagaattaataggctcactagaagcttat 174  Q
    |||||||| ||  ||||||||||||||| | || |||| || |||| || ||||||||||||||||||||||| |||||||||||||| |||||||||||    
4183 tattcctcataagtatgatgcaattgttgctacaattgagccaaccgaagatttgtctactttgtcagtgacataattaataggctcattagaagcttat 4282  T
175 gagcaaatattgagtaggc 193  Q
    ||| |||||||||||||||    
4283 gagaaaatattgagtaggc 4301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1630 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: scaffold1630
Description:

Target: scaffold1630; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 36 - 193
Target Start/End: Original strand, 813 - 970
Alignment:
36 tattctcgacaaaagaattgttgaggaaattcgaatttatattcctcgtagatatgatgcaattgttaccacgattgtgcaaaccaaatatttgtctact 135  Q
    ||||||||||||||||||||||||| |||||| ||||| |||||||  ||  ||||||||||| ||| | | ||||| | |||||||| || | ||||||    
813 tattctcgacaaaagaattgttgagaaaattctaatttctattccttataagtatgatgcaatcgtttctatgattgagaaaaccaaagatctatctact 912  T
136 ttgtcagtgacagaattaataggctcactagaagcttatgagcaaatattgagtaggc 193  Q
    |||||  ||| ||||| |||||||||| |||||| ||||||||||| |||||||||||    
913 ttgtccttgatagaatcaataggctcagtagaagtttatgagcaaagattgagtaggc 970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University