View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4061_high_30 (Length: 236)
Name: NF4061_high_30
Description: NF4061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4061_high_30 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 34170468 - 34170688
Alignment:
| Q |
16 |
gtatgttcctaaaggtagatttcgnnnnnnnncatttgattctgttagttggaagcatctagaatatatgctcaaccagatggggttccatgagaaatgg |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34170468 |
gtatgttcctaaaggtagatttcgaaaaaaaacatttgattctgttagttggaagcatctagaatatatgctcaaccagatggggttccatgagaaatgg |
34170567 |
T |
 |
| Q |
116 |
attaaatggatgagggattgtgttttctgaagctcaatgtcggttcttgtgtatggaagtccgacagaaaattttgaggtgaacaaagggttaaggcaag |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34170568 |
attaaatggatgagggattgcgttttctgaagctcaatgtcggttcttgtgtatggaagtccgacagaaaattttgaggtgaacaaagggttaaggcaag |
34170667 |
T |
 |
| Q |
216 |
gggacccactttctccattct |
236 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
34170668 |
gagacccactttctccattct |
34170688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University