View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4061_high_33 (Length: 205)
Name: NF4061_high_33
Description: NF4061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4061_high_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 4304977 - 4304786
Alignment:
| Q |
1 |
tagttgatatcctaccatgagaatgatctcgaccgttaatcacatttaaaatgatttgcttacgagtatataatttttcgtgttataacttttcgtacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4304977 |
tagttgatatcctaccatgagaatgatctcgaccgttaatcacacttaaaatgatttgcttacgagtatataatttttcgtgttataacttttcgtacct |
4304878 |
T |
|
| Q |
101 |
accgttaagattatgaatagaaaaaatgccatcgttgagagagaaagaaatatatttgaagaaggaaccatgtttataaatgttaatttttc |
192 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4304877 |
accgttaagattatgaatagaaaaaatactatcgttgagagagaaagaaatatatttgaagaaggaaccatgtttataaatgttaatttttc |
4304786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University