View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4061_low_10 (Length: 459)
Name: NF4061_low_10
Description: NF4061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4061_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 365; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 55 - 447
Target Start/End: Original strand, 365075 - 365466
Alignment:
| Q |
55 |
gcaactctctttcttatagcatttggtggttttagcgttgtatgcggttactggcggtagcatggctgaagcactttggcattcttggacttatgtagct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365075 |
gcaactctctttcttatagcatttggtggttt-agcgttgtatgcggttactggtggtagcatggctgaagcactttggcattcttggacttatgtagct |
365173 |
T |
 |
| Q |
155 |
gacgcaggaaatcacgctgaaacagaaggaaccggccagagaatcgtctctgtctcaattagtgcgggtggcatgcttatatttgccatgatgcttgggc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365174 |
gacgcaggaaatcacgctgaaacagaaggaaccggccagagaatcgtctctgtctcaattagtgcgggtggcatgcttatatttgccatgatgcttgggc |
365273 |
T |
 |
| Q |
255 |
ttgtttcggatgctatatcagagaaggttgattcacttagaaaaggaaagagcgaggtcatcgaaagaaaccatgtactcatccttggctggagtgacaa |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365274 |
ttgtttcggatgctatatcagagaaggttgattcacttagaaaaggaaagagcgaagtcatcgaaagaaaccatgtactcatccttggctggagtgacaa |
365373 |
T |
 |
| Q |
355 |
attggtaatcccctcattcattttcttagaaacatttagagtttttgaaattgaattagaatttgatgctcaggaatttagtttatatgatga |
447 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365374 |
attggtaatcccctcgttggttttcttagaaacatttagagtttttgaaattgaattagaatttgatgctcaggaatttagtttatatgatga |
365466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 365053 - 365003
Alignment:
| Q |
15 |
tgcataaggatatatggagaaaaatacatctaccatataagcaactctctt |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
365053 |
tgcataaggatatatggagaaaaatacatctaccatataagcaactctctt |
365003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University