View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4061_low_29 (Length: 239)
Name: NF4061_low_29
Description: NF4061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4061_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 65 - 211
Target Start/End: Original strand, 32399569 - 32399718
Alignment:
| Q |
65 |
gctataaagaagcggttttgaacccagaaaaga---acactcttaaagaaaagttacccagaaacgtgtaagcctttcttcttacttttcattcctattc |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32399569 |
gctataaagaagcggttttgaacccagaaaagaagaacactcttaaagaaaagttacccagaaatgtgtaagcctttcttcttacttttcattcctattc |
32399668 |
T |
 |
| Q |
162 |
aatttatcaannnnnnnaaggttttaataatcacttttctgaatttgcat |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32399669 |
aatttatcaatttttttaaggttttaataatcacttttctgaatttgcat |
32399718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 65 - 171
Target Start/End: Complemental strand, 48203577 - 48203468
Alignment:
| Q |
65 |
gctataaagaagcggttttgaacccagaaaagaa---cactcttaaagaaaagttacccagaaacgtgtaagcctttcttcttacttttcattcctattc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203577 |
gctataaagaagcggttttgaacccagaaaagaagaacactcttaaagaaaagttacccagaaacgtgtaagcctttcttcttacttttcattcctattc |
48203478 |
T |
 |
| Q |
162 |
aatttatcaa |
171 |
Q |
| |
|
|||||||||| |
|
|
| T |
48203477 |
aatttatcaa |
48203468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 48203446 - 48203404
Alignment:
| Q |
180 |
aggttttaataatcacttttctgaatttgcattatccagtcct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48203446 |
aggttttaataatcacttttctgaatttgcattattcagtcct |
48203404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University