View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4062_high_11 (Length: 232)
Name: NF4062_high_11
Description: NF4062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4062_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 8816203 - 8816424
Alignment:
| Q |
1 |
tttactcatgtacaatttataagcacttttgaatcttcaggataagtgaactttttctttcagattgtgcctgataacaatagcaaattccaagtacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8816203 |
tttactcatgtacaatttataagcacttttgaatcttcaggataagtgaactttttctttcagattgtacctgataacaatagcaaattccaagtacttt |
8816302 |
T |
|
| Q |
101 |
atcacctttacaaaatctacataaagtgatttatgtaattttgcattccgttgatcatacttcagataataatattcattgaactttatgatcactacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8816303 |
atcacctttacaaaatctacataaagtgatttatgtaattttgcattctgttgatcatacttgagataataatattcattgaactttatgatcactacca |
8816402 |
T |
|
| Q |
201 |
tgtatggacagagtattatcta |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8816403 |
tgtatggacagagtattatcta |
8816424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University