View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4062_low_12 (Length: 239)
Name: NF4062_low_12
Description: NF4062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4062_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 3 - 147
Target Start/End: Complemental strand, 36129446 - 36129302
Alignment:
| Q |
3 |
cagagaaatagatagatagagagaagggtagagggttttgtaaagttgctttgcttgtatatcattttgctcatttaatttacagtgagcataggaattg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129446 |
cagagaaatagatagatagagagaagggtagagggttttgtaaagttgctttgcttgtatatcattttgctcatttaatttacagtgagcataggaattg |
36129347 |
T |
|
| Q |
103 |
aattgaagagttagtgtaaagttgagagcgtattctttagtcttt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129346 |
aattgaagagttagtgtaaagttgagagcgtattctttagtcttt |
36129302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 174 - 239
Target Start/End: Complemental strand, 36129271 - 36129206
Alignment:
| Q |
174 |
tgtatgatggagtccctgaccaattccaccaattactaactccaagaacttcttcatcctcactac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
36129271 |
tgtatgatggagtccctgaccaattccaccaattcataactccaagaacttcttcatcatcactac |
36129206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University