View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4062_low_15 (Length: 203)
Name: NF4062_low_15
Description: NF4062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4062_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 80 - 188
Target Start/End: Original strand, 44866290 - 44866398
Alignment:
| Q |
80 |
gccatcagcaattgatttcggtttcgattctggttccgatggaacaatgttatcattatcggtggctacatttgcagcggtggtggtgcctggggcttcg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866290 |
gccatcagcaattgatttcggtttcgattctggttccgatggaacaatgttatcattatcggtggctacatttgcagcggtggtggtgcctggggcttcg |
44866389 |
T |
|
| Q |
180 |
agttctttg |
188 |
Q |
| |
|
||||||||| |
|
|
| T |
44866390 |
agttctttg |
44866398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University