View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4062_low_16 (Length: 201)
Name: NF4062_low_16
Description: NF4062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4062_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 4399996 - 4400167
Alignment:
| Q |
15 |
aatatataatcaatatttgatgttttagtttattttaggatcatccatttatggactctttatgttcaagttcaatagttgttactaattagtattaagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4399996 |
aatatataatcaatatttgatgttttagtttattttaggatcatccatttatggactctttatgttcaagttcaatagttgttactaattagtattaagt |
4400095 |
T |
 |
| Q |
115 |
attataatgcatgtttcattttcattcttcttatataatcttcttcaaatcatcaaataataatattgatat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4400096 |
attataatgcatgtttcattttcattcttcttatataatcttcttcaaatcatcaaataataatattgatat |
4400167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University