View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4063_high_18 (Length: 261)
Name: NF4063_high_18
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4063_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 251
Target Start/End: Original strand, 36161780 - 36162024
Alignment:
| Q |
15 |
tcattctctcaatttccggttattgtataaaactccctccttctttcttcatcaactgcacaaacctcgtttccctcaggttttccgg----at--atgc |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
36161780 |
tcattctctcaatttccagttattgtataaaactccctccttctttcttcatcaactgcacaaacctcgtttccctcaggttttccggtgccatcgata- |
36161878 |
T |
|
| Q |
109 |
tgctggttcaagattactcggttcattttccatcactgaagaagctctctctctcggcgcagacattgtgtgcac-----agattcattacttttctttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36161879 |
tgctggttcaagattactcggttcattttccatcactgaagaagctctctctc--ggcgcagacattgtgtgcacgccacagattcattacttttctttc |
36161976 |
T |
|
| Q |
204 |
tctctggctgccccaacctcgaaactttgcaggtttacttttactttg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161977 |
tctctggctgccccaacctcgaaactttgcaggtttacttttactttg |
36162024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 190 - 250
Target Start/End: Original strand, 26033957 - 26034017
Alignment:
| Q |
190 |
attacttttctttctctctggctgccccaacctcgaaactttgcaggtttacttttacttt |
250 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
26033957 |
attactttcctttctctctggcagccccaagctggaaactttgcaggtttacttttacttt |
26034017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 30077126 - 30077173
Alignment:
| Q |
44 |
aaactccctccttctttcttcatcaactgcacaaacctcgtttccctc |
91 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30077126 |
aaactccctccttccctcttcatcaactgcaacaacctcgtttccctc |
30077173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 42 - 95
Target Start/End: Original strand, 25923102 - 25923155
Alignment:
| Q |
42 |
taaaactccctccttctttcttcatcaactgcacaaacctcgtttccctcaggt |
95 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||| |||||||||||||| |||| |
|
|
| T |
25923102 |
taaaactctctccttctttattcatgaactgcagcaacctcgtttccctaaggt |
25923155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 217
Target Start/End: Complemental strand, 25031710 - 25031678
Alignment:
| Q |
185 |
gattcattacttttctttctctctggctgcccc |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
25031710 |
gattcattacttgtctttctctctggctgcccc |
25031678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University