View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4063_high_21 (Length: 244)
Name: NF4063_high_21
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4063_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 9699986 - 9699768
Alignment:
| Q |
16 |
cactaacaaaccagggaagcttccaccaacaattaataacttagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699986 |
cactaacaaaccagggaagcttccaccatcagttaataatgtagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctc |
9699887 |
T |
|
| Q |
116 |
ggagacaaacttggacgcaagaaagtttatggtgtcacactcattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccccgaaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9699886 |
ggagacaaacttggacgcaagaaagtttatggtgtcacactcattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccgcgaaat |
9699787 |
T |
|
| Q |
216 |
ctgttatgttaaccctttg |
234 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
9699786 |
ctgttatgataaccctttg |
9699768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University