View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4063_high_23 (Length: 231)
Name: NF4063_high_23
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4063_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 38360127 - 38359914
Alignment:
| Q |
1 |
tcttctttggtttatgcaaaaccagttggtgttgaagaagtgaattatggcagatagagcaaccaatctacaatgcggggaccaatttctttcagctatc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||| || |||||||||||||||| ||||||| |
|
|
| T |
38360127 |
tcttctttggtttatgcaaaaccagatggtgttgaagcagtgaattatggcagatagagcaaccagtctacattgtggggaccaatttcttttagctatc |
38360028 |
T |
 |
| Q |
101 |
cttatgatgtccaaaaaacatgaaaagtttcaggtgattttgagaatgtgaaacaaccagg-ccaaatgtcataagagaaagtgcattcaaggaacatgc |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38360027 |
cttatgatgtccaaaaaacttgaaaagtttcaggtgattttgagaatgtgaaacaaccaggaccaaatgtcataagagaaagtgcattcacggaacatgt |
38359928 |
T |
 |
| Q |
200 |
gagattgagtttct |
213 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38359927 |
gagattgagtttct |
38359914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University