View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4063_high_23 (Length: 231)

Name: NF4063_high_23
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4063_high_23
NF4063_high_23
[»] chr2 (1 HSPs)
chr2 (1-213)||(38359914-38360127)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 38360127 - 38359914
Alignment:
1 tcttctttggtttatgcaaaaccagttggtgttgaagaagtgaattatggcagatagagcaaccaatctacaatgcggggaccaatttctttcagctatc 100  Q
    ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||| || |||||||||||||||| |||||||    
38360127 tcttctttggtttatgcaaaaccagatggtgttgaagcagtgaattatggcagatagagcaaccagtctacattgtggggaccaatttcttttagctatc 38360028  T
101 cttatgatgtccaaaaaacatgaaaagtttcaggtgattttgagaatgtgaaacaaccagg-ccaaatgtcataagagaaagtgcattcaaggaacatgc 199  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||     
38360027 cttatgatgtccaaaaaacttgaaaagtttcaggtgattttgagaatgtgaaacaaccaggaccaaatgtcataagagaaagtgcattcacggaacatgt 38359928  T
200 gagattgagtttct 213  Q
    ||||||||||||||    
38359927 gagattgagtttct 38359914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University