View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4063_high_25 (Length: 220)
Name: NF4063_high_25
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4063_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 106 - 183
Target Start/End: Original strand, 53636452 - 53636530
Alignment:
| Q |
106 |
ctccctaacaattaacattgaatgaaatgcacaaaatgtgatttactc-aaaaataggatgttgtctttgaatttaggc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53636452 |
ctccctaacaattaacattgaatgaaatgcacaaaatgtgatttactcaaaaaataggatgttgtctttgaatttaggc |
53636530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 52 - 87
Target Start/End: Original strand, 53636398 - 53636433
Alignment:
| Q |
52 |
aaagcgtcacatcatagtataaggtccgtttatgta |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53636398 |
aaagcgtcacatcatagtataaggtccgtttatgta |
53636433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 122 - 192
Target Start/End: Complemental strand, 48333670 - 48333602
Alignment:
| Q |
122 |
attgaatgaaatgcacaaaatgtgatttactcaaaaataggatgttgtctttgaatttaggcaaagtcttt |
192 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
48333670 |
attgaatgaaatgcacaaaatgtggtttactc--aattaggatgatgtccttggatttaggcaaagtcttt |
48333602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University