View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4063_low_13 (Length: 368)
Name: NF4063_low_13
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4063_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 232 - 352
Target Start/End: Complemental strand, 32047950 - 32047829
Alignment:
| Q |
232 |
cggagaaattttattaaagataagcccgcacaagacaaacaacagtttgctacgaacaagataaaaacaagtcataaacacttat-aaaacttcgtcgaa |
330 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32047950 |
cggagaaattttattaaagataagcccgcccaagacaaacaacagtttgctacgaacaagataaaaacaagtcataaacacttataaaaacttcgtcgaa |
32047851 |
T |
|
| Q |
331 |
cacataatgatgcggtggttgc |
352 |
Q |
| |
|
||||||||||||| || ||||| |
|
|
| T |
32047850 |
cacataatgatgcagtagttgc |
32047829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 32048176 - 32048127
Alignment:
| Q |
1 |
gtccattttatcttaacgttaagttggaataatcaatatgtggagacaca |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32048176 |
gtccattttatcttaacgttaagttggaataatcaatatgtggagacaca |
32048127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 32048060 - 32048020
Alignment:
| Q |
117 |
gaattaaattttattttcattgaaacaacatttcacgtttg |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32048060 |
gaattaaattttattttcattgaaacaacatttcacgtttg |
32048020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 11113472 - 11113509
Alignment:
| Q |
119 |
attaaattttattttcattgaaacaacatttcacgttt |
156 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
11113472 |
attaagttttattttcaatgaaacaacatttcacgttt |
11113509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University