View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4063_low_24 (Length: 255)
Name: NF4063_low_24
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4063_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 237
Target Start/End: Complemental strand, 56098992 - 56098767
Alignment:
| Q |
12 |
atcatcaaaaccaagcttactcatagcccaaagcacatcttctgcagttattgtcttcctttgctctctctgacaacgttcattggcttctccagttatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56098992 |
atcatcaaaaccaagcttactcatagcccaaagcacatcttctgcagttattgtcttcctttgctctctctgacaacgttcattggcttctccagttatg |
56098893 |
T |
|
| Q |
112 |
aagctgatgtactcagacacacactcttggattgtttcttttgcatcatcagatatttttgcatgtggtggtagaattttgcgcatgatccttatcacat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56098892 |
aagctgatgtactcagacacacactcttggattgtttcttttgcatcatcagatatttttgcatgtggtggtagaatcttgcgcatgatccttatcacat |
56098793 |
T |
|
| Q |
212 |
ttgcaattggcataaaacggtcttgt |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
56098792 |
ttgcaattggcataaaacggtcttgt |
56098767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 9722763 - 9722705
Alignment:
| Q |
97 |
gcttctccagttatgaagctgatgtactcagacacacactcttggattgtttcttttgc |
155 |
Q |
| |
|
||||||||||||||||| ||||| |||| || ||||||||||| | |||||||||||| |
|
|
| T |
9722763 |
gcttctccagttatgaaactgataaactctgatacacactcttgtactgtttcttttgc |
9722705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 176
Target Start/End: Original strand, 14394123 - 14394287
Alignment:
| Q |
12 |
atcatcaaaaccaagcttactcatagcccaaagcacatcttctgcagttattgtcttcctttgctctctctgacaacgttcattggcttctccagttatg |
111 |
Q |
| |
|
||||||||||||||| || | ||| ||||| || | ||||||||| || | ||| || ||||| ||||| || || || || || ||||| |||||| |
|
|
| T |
14394123 |
atcatcaaaaccaagtttccccattgcccatagtatatcttctgctgtaactgtttttctttgttctctttggcatcgatcgtttgcttcggatgttatg |
14394222 |
T |
|
| Q |
112 |
aagctgatgtactcagacacacactcttggattgtttcttttgcatcatcagatatttttgcatg |
176 |
Q |
| |
|
||||| ||||| || || ||||| ||||| || ||||||||||| || || || ||||||||||| |
|
|
| T |
14394223 |
aagcttatgtattcggatacacattcttgaatggtttcttttgcgtcgtcggagatttttgcatg |
14394287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University