View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4063_low_25 (Length: 250)
Name: NF4063_low_25
Description: NF4063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4063_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 38173829 - 38174059
Alignment:
| Q |
1 |
tccgaaagaggaggaggagaatcaggggcataatcaaaattaatgaaggaatcggcgagggcgaaatcgtggtcgttgttgtccatattttttgtggagg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
38173829 |
tccgaaagaggaggaggggaatcaggggcataatcaaaattaatgaaggaatcggcgagggcgaaaacgtcgtcgtcgttgtccatgttttttgtggagg |
38173928 |
T |
 |
| Q |
101 |
cgcggcggaagagggattaggtttagggttaacagaaagatttgatggaattaatagcgaaaatatgtacttggtttccatatcggcaaccaatgagggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38173929 |
cgcggcggaagagggattaggtttagggttaacaaaaagatttgatggaattaatagcgaaaatttgtacttggtttccatatcggcaaccaatgagggt |
38174028 |
T |
 |
| Q |
201 |
ttcggttttggtttctttttggaaatgctta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38174029 |
ttcggttttggtttctttttggaaatgctta |
38174059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 131 - 208
Target Start/End: Complemental strand, 26415363 - 26415287
Alignment:
| Q |
131 |
aacagaaagatttgatggaattaatagcgaaaatatgtacttggtttccatatcggcaaccaatgagggtttcggttt |
208 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
26415363 |
aacacaaagatttcgtggaattaatagaaaaaat-tgtacttggtttccatatcggcaaccaatgaggatttaggttt |
26415287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 203
Target Start/End: Original strand, 26416826 - 26416898
Alignment:
| Q |
131 |
aacagaaagatttgatggaattaatagcgaaaatatgt-acttggtttccatatcggcaaccaatgagggtttc |
203 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||||| |||| || || |||||||||||| |||||||||||||||| |
|
|
| T |
26416826 |
aacataaagatttggtggaattaatag-gaaaaaatgtgacatgctttccatatcgggaaccaatgagggtttc |
26416898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University