View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4064_low_14 (Length: 355)
Name: NF4064_low_14
Description: NF4064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4064_low_14 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 20 - 344
Target Start/End: Complemental strand, 318068 - 317745
Alignment:
| Q |
20 |
caagagggtctcaaagagaaagataggattaagagtcttccagggcaaccatgggtgaaagtctctcaatttggagggtatgtcaaattggataaattgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
318068 |
caagagggtctcaaagagaaagataggattaagagtcttccagggcaaccattggtgaaattctctcaatttggagggtatgtcaaattggataaattgg |
317969 |
T |
 |
| Q |
120 |
gtggtagagccttttactattactttgttgaagctcaacattccaaagaaacacttccccttcttctttggctcaatggaggtaaaaataatctatctat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
317968 |
gtggtagagccttttactattactttgttgaagctcaacattctaaagaaacacttccccttcttctttggctcaatggaggtaaaaataatctatctat |
317869 |
T |
 |
| Q |
220 |
tgttattattaaatttgattgactagtctttgttcataatgtaccttgttggttgttcaagtgtcctgaaattaatgtgacaactatttttgtgctttta |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
317868 |
tgttattattaaatttgattgactagtctttgttcataatgtaccttgttggttgttcaagtgtcctgaaattaatgtgacaactatttttgtgc-ttta |
317770 |
T |
 |
| Q |
320 |
tttaatttgaaagtcctatagtata |
344 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
317769 |
tttaatttgaaagtcctatagtata |
317745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 74 - 203
Target Start/End: Complemental strand, 11088227 - 11088098
Alignment:
| Q |
74 |
gtgaaagtctctcaatttggagggtatgtcaaattggataaattgggtggtagagccttttactattactttgttgaagctcaacattccaaagaaacac |
173 |
Q |
| |
|
|||||| ||||||||| |||||||||||| | | | || ||| | | || || || ||||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
11088227 |
gtgaaattctctcaatatggagggtatgttacaattgacaaaatagcaggaagtgctttttactattactttgtggaagctcatcattctaaagaaacat |
11088128 |
T |
 |
| Q |
174 |
ttccccttcttctttggctcaatggaggta |
203 |
Q |
| |
|
| || ||||||||||||||||||||||||| |
|
|
| T |
11088127 |
tgcctcttcttctttggctcaatggaggta |
11088098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University