View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4064_low_22 (Length: 281)
Name: NF4064_low_22
Description: NF4064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4064_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 47900457 - 47900203
Alignment:
| Q |
1 |
aaatgtgttgattctcatgagtgatactggtggtggacatagagcttctgctgaggctattcgtgatgcttttcaaattgaattcggtgatgaatacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47900457 |
aaatgtgttgattctcatgagtgatactggtggtggacatagagcttctgctgaggctattcgtgatgcttttcaaattgaattcggtgatgaatacaag |
47900358 |
T |
|
| Q |
101 |
gtactttaatcacacttccttgtgttttggatctgttgcagcttttgtttcaaactgtgtagattttgttgtgttagagttttctgatctgtatattttt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47900357 |
gtactttaatcacacttccttctgttttggatctgttgcagcttttgttttaaactgtgtagattttgttgtgttagagttttctgatctgtatattttt |
47900258 |
T |
|
| Q |
201 |
ctatggttcacatgtttttgtcgtgtcttacgctttatttgtacggattttgtcg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47900257 |
ctatggttcacatgtttttgtcgtgtcttacactttatttgtacggattttgtcg |
47900203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University