View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4064_low_24 (Length: 259)
Name: NF4064_low_24
Description: NF4064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4064_low_24 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 318311 - 318080
Alignment:
| Q |
18 |
ttcattcccccttgtgaatcttcatagaaagacacaacaaataaaaacacaatgagaaaagcaaatagttattctcttcttctatcctttctaattcttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
318311 |
ttcattcccccttgtgaatcttcatagaaagacacaacaaataaaaacacaatgagaaaagcaaatagttattctcttcttctatcctttctaattcttt |
318212 |
T |
|
| Q |
118 |
catactttgtgattgaaatccatggaaaccaacaagttaaagctcttgacaatcttcacaaggagaaatacaaaggaaattcacaaattgataggagtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
318211 |
catactttgtgattgaaatccatggaaaccaacaagttaaagctcttgacaatcttcacaaggagaaatacaaaggaaattcacaaattgataggagtga |
318112 |
T |
|
| Q |
218 |
atttgaggtacaagaaattgtgtatgatgatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
318111 |
atttgaggtacaagaaattgtgtatgatgatg |
318080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University