View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4066_high_14 (Length: 238)
Name: NF4066_high_14
Description: NF4066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4066_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 149 - 233
Target Start/End: Complemental strand, 10783052 - 10782969
Alignment:
| Q |
149 |
ctattattggacatcacaatcaaaaaagctacatatataagttgacatttttagattgctaatagaatatatgaaaatgatgatg |
233 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10783052 |
ctattattggacatcacaattaaaacagctgtatatataagttgacatttttagattgctaatag-atatatgaaaatgatgatg |
10782969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 152 - 232
Target Start/End: Complemental strand, 10775477 - 10775399
Alignment:
| Q |
152 |
ttattggacatcacaatcaaaaaagctacatatataagttgacatttttagattgctaatagaatatatgaaaatgatgat |
232 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
10775477 |
ttattggacatcacaattaaaacagctagatatataagttgacatttttagatttgtaataga--atatgaaaatgatgat |
10775399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 6 - 75
Target Start/End: Complemental strand, 10775604 - 10775535
Alignment:
| Q |
6 |
atagaagattaattgtgatgattaatttgattataaaattaaaagtaaaagatcttcatccacaagcaag |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| || ||| ||||||| |||||||||||||| |
|
|
| T |
10775604 |
atagaagattaattgtgatgattaatttgactataaaatgaatagtccaagatctccatccacaagcaag |
10775535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 78
Target Start/End: Complemental strand, 10783180 - 10783124
Alignment:
| Q |
22 |
gatgattaatttgattataaaattaaaagtaaaagatcttcatccacaagcaagttc |
78 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| || |||| |||||||||| |||||| |
|
|
| T |
10783180 |
gatgattaatttgaatataaaattaatagttcaaaatctccatccacaagtaagttc |
10783124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University