View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4066_high_16 (Length: 231)
Name: NF4066_high_16
Description: NF4066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4066_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 51 - 198
Target Start/End: Complemental strand, 2981814 - 2981666
Alignment:
| Q |
51 |
aaatatagaattttttatggtgttagggacactcatttactagcataaactaatgataagattccc-aagttaaatgcatattgtaacatttgcaataaa |
149 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
2981814 |
aaatttagaattttttatggtgttagggacattcatttactagcataaactaatgaaaagattccccaagttaaatgcatattgtaccatttgcaatatt |
2981715 |
T |
 |
| Q |
150 |
tgtcgttcataggtcaatggaatcatagagagcaaggtggtggcttaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2981714 |
tgtcgttcataggtcaatggaatcatagagagcaaggtggtggcttaat |
2981666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 163 - 214
Target Start/End: Complemental strand, 2949862 - 2949811
Alignment:
| Q |
163 |
tcaatggaatcatagagagcaaggtggtggcttaatgtagcctaagatggct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2949862 |
tcaatggaatcatagagagcaaggtggtggcttaatgtagcctaaggtggct |
2949811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 2978198 - 2978158
Alignment:
| Q |
17 |
caaggtttgaaaaaatgcattagttacacctagaaaatata |
57 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| |||| |
|
|
| T |
2978198 |
caaggtttgaaaaaatgcattaattacatctagaaagtata |
2978158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University