View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4067_low_14 (Length: 311)
Name: NF4067_low_14
Description: NF4067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4067_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 94 - 301
Target Start/End: Complemental strand, 7616120 - 7615913
Alignment:
| Q |
94 |
cttagcttcataaaagtatttcttgaattttctactttttgaaaattctcaaaactaatttccaaacgaagtaatttatattaaagagttaaattacccc |
193 |
Q |
| |
|
|||||||| ||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7616120 |
cttagctttataaaagcatttcatgaaatttctactttttgaaaattctcaaaactaatttccaaacgaagtaatttatattaaagagttaaattacccc |
7616021 |
T |
|
| Q |
194 |
gtaaaatttccccatagaaacaaacacaatatcaagaaaattacnnnnnnnnnnnnnnnnttataactagaaaatgtttaaggcaaaaataattaccaaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7616020 |
gtaaaatttccccatagaaacaaacacactatcaagaaaattacaaaaagaaaaaaaaaattataactagaaaatgtttaaggcaaaaataattaccaaa |
7615921 |
T |
|
| Q |
294 |
tgatgatg |
301 |
Q |
| |
|
|||||||| |
|
|
| T |
7615920 |
tgatgatg |
7615913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University