View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4067_low_26 (Length: 245)
Name: NF4067_low_26
Description: NF4067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4067_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 189
Target Start/End: Complemental strand, 26225892 - 26225835
Alignment:
| Q |
132 |
gacaacagtggtaatggaggtgttggttatgtgtatgagtataacaacaatgacggta |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26225892 |
gacaacagtggtaatggaggtgttggttatgtgtatgagtataacaacaatgacggta |
26225835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 26226035 - 26225980
Alignment:
| Q |
1 |
aagattatgagtatgattatgatgtcgacgatggtggtgatgaagttgttggttacgtg |
59 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26226035 |
aagattatgagtatgattataatgtcgacgatggtgg---tgaagttgttggttacgtg |
26225980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University