View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4069_low_5 (Length: 240)
Name: NF4069_low_5
Description: NF4069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4069_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 31193334 - 31193543
Alignment:
| Q |
19 |
cttattccactcttgtatctcatatttacattttaaagatcatcattccacgacatcactgaatttctgttttgctacatgaagatatcaaaatcggtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31193334 |
cttattccactcttgtatctcatatttacattttaaagatcatcattccacgacatcactgaatttctgttttgctacatgaagatatcaaaattggtgt |
31193433 |
T |
 |
| Q |
119 |
aagcatgatacttaaaggccctaccgttttgttgttctgtcatcaaaatcttgattggtggtctaagaagaagaaaacctaaaggacctgtgtagtctct |
218 |
Q |
| |
|
|||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31193434 |
aagcatgaaacttaaaggccctactgtttggttgttctgtcatcaaaatcttgattggtggtctaagaagaagaaaacctaaaggacctgtgtagtctct |
31193533 |
T |
 |
| Q |
219 |
tcctttgctt |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
31193534 |
tcctttgctt |
31193543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University