View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4070_high_16 (Length: 250)
Name: NF4070_high_16
Description: NF4070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4070_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 242
Target Start/End: Original strand, 10251471 - 10251714
Alignment:
| Q |
5 |
agtgtcaatgcccgaatttggaaactaaaattccaaacctgaaatgtaaacgttctaatcttgatctaaccaacaaccaaagatattaatgcaatcatcc |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
10251471 |
agtgtcaatgtccgaatttggaaactaaaattccaaacctgatatctaaacgttctaatcttgatctaaccaacaaccgaagatattaatgaaatcatcc |
10251570 |
T |
 |
| Q |
105 |
gaattcctcttaggttatatatgccaactagtcgatg------tgtttctaatattctggcaggttgatttggttagcaacataggtttggttggtcatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251571 |
gaattcctcttaggttatatatgccaactagtcgatgctcccatgtttctaatattctggcaggttgatttggttagcaacataggtttggttggtcatg |
10251670 |
T |
 |
| Q |
199 |
tttcgtttggcgatgttctattgcctctaatttattcctatgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251671 |
tttcgtttggcgatgttctattgcctctaatttattcctatgct |
10251714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University