View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4070_high_18 (Length: 239)
Name: NF4070_high_18
Description: NF4070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4070_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 10251002 - 10250797
Alignment:
| Q |
18 |
atattgggctaagcagataatcaaa----atagatagataatagttgtctgcctccaatttcactaacactcactttcaagttattttggtttggggaat |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251002 |
atattgggctaagcagataatcaaattaaatagatggataatagttgtctgcctccaatttcactaacactcactttcaagttattttggtttggggaat |
10250903 |
T |
 |
| Q |
114 |
taagctcaagtataaggcagtttggttaggtggttggttcacctatttcttcaaagatatatattatatagattggtctagagtttttaatccattgcca |
213 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
10250902 |
taagctcaattatacggcagtttggttaggtggttggttcacctatttcttcaaagatagat----tatagattggtctagagtttttaatccattgcca |
10250807 |
T |
 |
| Q |
214 |
cgttttttat |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
10250806 |
cgttttttat |
10250797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University