View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4070_high_9 (Length: 315)
Name: NF4070_high_9
Description: NF4070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4070_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 4676912 - 4677191
Alignment:
| Q |
1 |
ctaatagacctatccaatgattttcgccactgagttgttgccatttgtttgctatgttgctgctgttgtttggtttcttcttcttcaaattgtttctcca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676912 |
ctaatagacctatccaatgattttcaccactgagttgttgccatttgtttgctatgctgctgctgttgtttggtttcttcttcttcaaattgtttctcca |
4677011 |
T |
 |
| Q |
101 |
tcttttgatcatgattgctactctgcttggnnnnnnnatgtatggaaccagagaggccttcaccttcatatatactacgtacaaaaataatttgtatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4677012 |
tcttttgatcatgattgctactctgcttggtttttttatgtatggaaccagagaggccttcaccttcatatatactacgtacaaaaataatttgtatttg |
4677111 |
T |
 |
| Q |
201 |
actttcgaaggataggacaattattggctcaatttaatgtttgaggttgtttcatgttataatcatagtatattgttgag |
280 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4677112 |
actttcgaaggataggacaattatgggctcaatttaatgtttgaggttgttttatgttataatcatagtatattgttgag |
4677191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University