View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4070_low_12 (Length: 309)
Name: NF4070_low_12
Description: NF4070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4070_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 17 - 303
Target Start/End: Complemental strand, 7175415 - 7175129
Alignment:
| Q |
17 |
tagtaagttcttcacaatttaagaatttaaaatgtttcatcaaatttgtgggtcaatttttgtctctacgcgatgaatcaacaatattgcatgatttcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175415 |
tagtaagttcttcacaatttaagaatttaaaatgtttcatcaaatttgtgggtcaatttttgtctctacgcgatgaatcaacaatattgcatgatttcaa |
7175316 |
T |
 |
| Q |
117 |
atttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatacgttgtttcacataatatcgaaaggattttcgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7175315 |
atttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatatgttgtttcacataatatcgaaaggattttcgaa |
7175216 |
T |
 |
| Q |
217 |
tatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatcaactactttccaccaagcttcttttcatctcac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7175215 |
tatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatcaactactttccgccaagcttcttttcatgtcac |
7175129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University