View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4070_low_14 (Length: 289)
Name: NF4070_low_14
Description: NF4070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4070_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 26 - 273
Target Start/End: Complemental strand, 10251044 - 10250797
Alignment:
| Q |
26 |
agcttagacactattgtctagtgtacacacagtctattatcaatattgggctaagcagataatcaaa----atagatagataatagttgtctgcctccaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
10251044 |
agcttagacactattgtctagtgtacacacagtctattatctatattgggctaagcagataatcaaattaaatagatggataatagttgtctgcctccaa |
10250945 |
T |
 |
| Q |
122 |
tttcactaacactcactttcaagttattttggtttggggaattaagctcaagtataaggcagtttggttaggtggttggttcacctatttcttcaaagat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10250944 |
tttcactaacactcactttcaagttattttggtttggggaattaagctcaattatacggcagtttggttaggtggttggttcacctatttcttcaaagat |
10250845 |
T |
 |
| Q |
222 |
atatattatatagattggtctagagtttttaatccattgccacgttttttat |
273 |
Q |
| |
|
| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10250844 |
agat----tatagattggtctagagtttttaatccattgccacgttttttat |
10250797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University