View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4070_low_9 (Length: 319)
Name: NF4070_low_9
Description: NF4070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4070_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 40935831 - 40935532
Alignment:
| Q |
1 |
tgagtgaggtattttatgtggttgcttagacatggaagactcatgaaaaattatcgtaaaatgcagaatgaaccttggcgctcccctctagtgatgttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40935831 |
tgagtgaggtattttatgtggttgcttagacatggaagactcatgaaaaattatcgtaaaatgcagaatgaaccttggcgctcccctctagtgatgttac |
40935732 |
T |
 |
| Q |
101 |
cgagatagagctacatgtattatgggattgctctcaatgcatggttgttggatcccagttgagggagttattttttcaactcgaatttgcaatagtggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40935731 |
cgagatagagctacatgtattatgggattgctctcaatgcatggttgttggatcccagttgagggagttattttttcaactcgaatttgcaatagtggat |
40935632 |
T |
 |
| Q |
201 |
caatttgaacttaaaaggagaggttgaaaggattgatatttctaacccgcaagcattttaggttactgcttgtcattccctctggaagtggtgaaataag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40935631 |
caatttgaacttaaaaggagaggttgaaaggattgatatttctaacccgcaagcattttaggttactgcttgtcattccctctggaagtggtgaaataag |
40935532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University