View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4071_high_11 (Length: 227)
Name: NF4071_high_11
Description: NF4071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4071_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 37997896 - 37997767
Alignment:
| Q |
1 |
ccaccattcagtataatcgtttttgatcaatgcagaatttcttctatattatttgggtttggttattggccaaaccagccaaacatgttacaaaatgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37997896 |
ccaccattcagtataatcgtttttgatcaatgcagaatttcttctatattatttgggtttggttattggccaaaccagccaaacatgttacaaaatgctc |
37997797 |
T |
 |
| Q |
101 |
ttatagcaaacaatttaacagtactgctat |
130 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
37997796 |
ttataacaaacaatttaacagtactgctat |
37997767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 171 - 221
Target Start/End: Complemental strand, 37997726 - 37997676
Alignment:
| Q |
171 |
gagcaagaagaattgaagaattcacttgtctggtgtttgttatatattatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37997726 |
gagcaagaagaattgaagaattcacttgtctggtgtttgttatatattatc |
37997676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University