View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4071_low_15 (Length: 221)
Name: NF4071_low_15
Description: NF4071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4071_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 24 - 203
Target Start/End: Original strand, 2113303 - 2113482
Alignment:
| Q |
24 |
gtaaccatgaccaaacatgaacatgaaacaccaccgtcaaaccgaacaaacctagcttcatgtttggtcgccaccgttttcttaatcttcattctcatca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2113303 |
gtaaccatgaccaaacatgaacatgaaacaccaccgtcaaaccgaacaaacctagcttcatgtttggtcgccaccgttttcttaatcttcattctcatca |
2113402 |
T |
 |
| Q |
124 |
taatcttcacactttacttcacacttttcaaacctcaagatccaaaaatctccgtcaccgccgttcaactcccatcattc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2113403 |
taatcttcacactttacttcacacttttcaaaccacaagatccaaaaatttccgtcaccgccgttcaactcccatcattc |
2113482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University