View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4071_low_16 (Length: 220)
Name: NF4071_low_16
Description: NF4071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4071_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 56043330 - 56043133
Alignment:
| Q |
1 |
tagttagtggttgagttctgaaagtgaagaaagtgttgagaaagatgagtatgatgcaagaagtaattccaaggaaccatgaacggaaagtcatgactgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043330 |
tagttagtggttgagttctgaaagtgaagaaagtgttgagaaagatgagtatgatgcaagaagtaattccaaggaaccatgaacggaaagtcatgactgg |
56043231 |
T |
 |
| Q |
101 |
aagagaagggtcgtcggtttcagggacgacgagagctacttcttcaattggacatctgtcgtctgggggaacaccgtttgacgctttttcagtgtctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56043230 |
aagagaagggtcgtcggtttcagggacgacgagagctacttcttcaattggacatctgtcgtctgggggaacaccgtttgacgctttttcagtgtctg |
56043133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University