View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4071_low_6 (Length: 320)
Name: NF4071_low_6
Description: NF4071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4071_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 50159190 - 50159467
Alignment:
| Q |
19 |
tattttccttaataattcttcaaaatcattcccttgttttaattaattaaaattgcttgttttctgttacagtgcgaagtcatggctgcctccatcaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50159190 |
tattttccttaataattcttcaaaatcattcccttgttttaattaattaaaattgcttgttttctgttacagtgcgaagtcatggctgcctccatcaaac |
50159289 |
T |
 |
| Q |
119 |
acatggctctcgctgtttcgttacttggtttcgtctctttcatactcggtgttattgccgaaaacaaaaaggtagtattactctttcttaccttttcatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
50159290 |
acatggctctcgctgtttcgttacttggtttcgtctctttcatactcggtgttattgccgaaaacaaaaaggtagcattactctttcttactttttcatc |
50159389 |
T |
 |
| Q |
219 |
aaaaatcaattatttatctttgtgtaaagaatgtcgcgtcaatatcatctaatcaacttttgactttaatttatctat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50159390 |
aaaaatcaattatttatctttgtgtaaagtatgtcgcgtcaatattatctaatcaacttttgactttaatttatctat |
50159467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 100 - 182
Target Start/End: Complemental strand, 22988642 - 22988555
Alignment:
| Q |
100 |
atggctgcctccatcaaacacatggctctcgctgtttcgttacttgg-----tttcgtctctttcatactcggtgttattgccgaaaa |
182 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||| |||||||| |
|
|
| T |
22988642 |
atggctgccttcgtcaaacacatggctctcgctgtttcgttacttggtgtcatctcttctctttcatactcggtgttatagccgaaaa |
22988555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University