View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4071_low_8 (Length: 286)
Name: NF4071_low_8
Description: NF4071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4071_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 13 - 136
Target Start/End: Complemental strand, 17279647 - 17279525
Alignment:
| Q |
13 |
tcatcatctggtattgttgctgacatctcattgtcccatctgnnnnnnnnnttaaattaattcctcttaattagctttaatttttataaatttatataat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17279647 |
tcatcatctggtattgttgctgacatctcattgtcccatctgaaaaaaat-taaaattaattcagcttaattagctttaatttttataaatttatataat |
17279549 |
T |
 |
| Q |
113 |
ggaaggaaaataaatgaattaaga |
136 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
17279548 |
ggaagaaaaataaatgaattaaga |
17279525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 210 - 286
Target Start/End: Complemental strand, 17279357 - 17279281
Alignment:
| Q |
210 |
catatgaaatgatgaatctagattgattgactgtatgacaaattttacattgacaatacataaatattattataact |
286 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| |||||||||||||||||||||| || |||||| |||||||||||| |
|
|
| T |
17279357 |
catacgaaatgatgaatcgagattgattgacggtatgacaaattttacattgacgatgcataaaaattattataact |
17279281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University