View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4072_high_12 (Length: 328)
Name: NF4072_high_12
Description: NF4072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4072_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 103 - 317
Target Start/End: Complemental strand, 44733091 - 44732882
Alignment:
| Q |
103 |
gtagcttaatttgtaaggctaatgacatgcctttctaattttagacacaaaccaagttcttcttggttgtttagggtgatcaaagtctctcttattttga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44733091 |
gtagcttaatttgtaaggctaatgacatgcctttctaattttagacacaaaccaagttcttcttggttgtttagggtgatcaaagtctctcttattttga |
44732992 |
T |
|
| Q |
203 |
atttatcatgtaaatagtgccacttagctttacccttcttgcaggttgtttaagttttgaatgaaaagtgattaatcagtagaagcgagttgatagtttt |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44732991 |
atttatcatgtaaatagtgcca-----ctttactcttcttgcaggttgtttaactttttaatgaaaagtgattaatcagtagaagcgagttgatagtttt |
44732897 |
T |
|
| Q |
303 |
gtgttcactgttcat |
317 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44732896 |
gtgttcactgttcat |
44732882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 44733176 - 44733119
Alignment:
| Q |
18 |
ctatgcagcagcatcaataaattgagcaaatgaaagagtggaaaaaatatctccaaga |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44733176 |
ctatgcagcagcatcaataaattgagcaaatgaaagagtggaaaaaatatctccaaga |
44733119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University