View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4072_high_16 (Length: 284)
Name: NF4072_high_16
Description: NF4072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4072_high_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 85 - 284
Target Start/End: Complemental strand, 56099467 - 56099262
Alignment:
| Q |
85 |
ttattaatttgagtactactacatagttaggatagggattctaactagcttctcctttgatgttcatgatgaatcatcaaacaaaa------caactact |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
56099467 |
ttattaatttgagtactactacatagttaggatagggattctaactagcttctcctttgatgttcatgatgaatcatcaaacaaaaacaaaacaactact |
56099368 |
T |
 |
| Q |
179 |
cgatcatagttaagcataaaataataagtcttggtgatgtctgtccagtactcatttatattgatggtgatgatgatgaccattggcttcagcatttgca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56099367 |
cgatcatagttaagcataaaataataagtcttggtgatgtctgtccagtactcatttatattgatggtgatgatgatgaccattggcttcagcatttgca |
56099268 |
T |
 |
| Q |
279 |
agtgcc |
284 |
Q |
| |
|
|||||| |
|
|
| T |
56099267 |
agtgcc |
56099262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University