View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4072_low_12 (Length: 337)
Name: NF4072_low_12
Description: NF4072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4072_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 24848934 - 24849211
Alignment:
| Q |
1 |
ttcttgaaaggtgctttgaaccttataagtgagttggctgaaccaccaacacgaagttcttcgactatgtcaccggtttgaagcatgtctccggtccatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24848934 |
ttcttgaaaggtgctttgaaccttataagtgagttagctgaaccaccaacacgaagttcttcgactatgtcaccggtttgaagcatgtctccggtccatt |
24849033 |
T |
|
| Q |
101 |
cgtcggattttgagctgcctttgtagcattctatggaaaggactttgaagtctcgagagggtgagtctgaggattttgagctgctttgtgaagatgatcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24849034 |
cgtcggattttgagctgcctttgtagcattctatggataggactttgaagtctcgagagggtgagtctgaggattttgagctgctttgtgaagatgatcg |
24849133 |
T |
|
| Q |
201 |
gtccatggtcatggtttgtgaaggtttggattttgtttgagatgagtttggtttgtataggggagaaagagaaagtga |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
24849134 |
gtccatggtcatggtttgtgaaggtttggattttgtttgagatgagtttggtttgtatgtgggataaagagaaagtga |
24849211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 52 - 101
Target Start/End: Complemental strand, 42041497 - 42041448
Alignment:
| Q |
52 |
cgaagttcttcgactatgtcaccggtttgaagcatgtctccggtccattc |
101 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
42041497 |
cgaagctcttcgactatgtcgccggtttgaagcatgtctactgtccattc |
42041448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University