View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4072_low_13 (Length: 334)
Name: NF4072_low_13
Description: NF4072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4072_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 13 - 317
Target Start/End: Original strand, 42060510 - 42060817
Alignment:
| Q |
13 |
cagagagcatagattaaatttgactttttcaatgaagcaataaaggatactctattagttcta---tcttaaaccagctaagataaatacgtacgtcatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42060510 |
cagagagcatagattaaatttgacttttccaatgaagcaataaaggatactctattagttctactatcttaaaccagctaagataaatacgtacgtcatt |
42060609 |
T |
 |
| Q |
110 |
atcttaggctaattactggatttcaaagaaagaataacgttgttagcaattaaataacatgggatttaacttcacgagcttctcattagattgtttatta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42060610 |
atcttaggctaattactggatttcaaagaaagaataacgttgttagcaattaaataacatgggatttaacttcacgagcttctcattagattgtttatta |
42060709 |
T |
 |
| Q |
210 |
ctttatttggtcttcttannnnnnnattcctattttacttttggaccttgtcatatagatattgcttaaatgtaacctagaattaatatgaacggcaatg |
309 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42060710 |
ctttatttggtcttcttatttttttattcctattttacttttggaccttgtcatatagatattgcttaaatgtaacctagaatttatatgaacggcaatg |
42060809 |
T |
 |
| Q |
310 |
gtctttat |
317 |
Q |
| |
|
|||||||| |
|
|
| T |
42060810 |
gtctttat |
42060817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University