View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4072_low_21 (Length: 261)
Name: NF4072_low_21
Description: NF4072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4072_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 45701891 - 45702120
Alignment:
| Q |
1 |
catgttaaaaaatgggtccattgatgaacactcattttctcgttttttaattg-----cattgcatggactaataatcaagcgaatgtcacccacatgtt |
95 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45701891 |
catgttaaaaaatgggtccatctatgaacactcattttctcgttttttaattgcattgcattgcatggactaataatcaagcgaatgtcacccacatgtt |
45701990 |
T |
 |
| Q |
96 |
atgatggatcgtgtgccagatggtttctttagtgaataaggacttaatttgatcctattattgtctattcaatttagtctctaaattattattctttcag |
195 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45701991 |
atgctggatcgtgtgccagatggtttctttagtgaataaggacttaatttgatcctattatt--------------gtctctaaattattattctttcag |
45702076 |
T |
 |
| Q |
196 |
ttnnnnnnnntagtgataatttaaagaacaaattaactatttat |
239 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||||| |
|
|
| T |
45702077 |
ttaaaaaaaatattgataatttaaagaacaaattaactatttat |
45702120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University