View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4073_high_17 (Length: 250)
Name: NF4073_high_17
Description: NF4073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4073_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 80 - 243
Target Start/End: Complemental strand, 25682587 - 25682424
Alignment:
| Q |
80 |
cagtgtttaatttgtaaatatagataaggaggaacaaaccccgtgattcccgacgaaagagcatatatttcacattacattatattttagagaggtttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25682587 |
cagtgtttaatttgtaaatatagataaggaggaacaaaccccgtgattcccgacgaaagagcatatatttcacattacattatattttggagaggtttta |
25682488 |
T |
 |
| Q |
180 |
ggtctgcatcagagacagcacagcatcacatttcacagtctcacacacatgacatcctatgcta |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
25682487 |
ggtctgcatcagagacagcacagcatcacatttcacagtctctcacacatgacatcctctgcta |
25682424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University