View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4073_low_18 (Length: 312)
Name: NF4073_low_18
Description: NF4073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4073_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 20 - 301
Target Start/End: Original strand, 35083910 - 35084191
Alignment:
| Q |
20 |
catcggtggcatcaaataaccttattgaagaaggaccattagaaccttgggagctgaatgaatagttatccaaaggagacaacaagtcaatcgactttgg |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
35083910 |
catcggtggcatcagataaccttattgaagaaggaccattagagccttgggagctgaatgaatagttatccaaaggagacgacaagtcaatcgaccttgg |
35084009 |
T |
|
| Q |
120 |
tcctccaccagaataggatgaatcgaagctgtttcttgcatcgtattcggatgaaagcctaccagtaggatgtccattactaatactactattggagtct |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35084010 |
tcctccaccagaataggatgaagcgaagctgtttcttgcatcgtattcggatgaaagcctaccagtaggatgtccattactaatactactattggagtct |
35084109 |
T |
|
| Q |
220 |
agatcatcattgttatataatgaaggaaatattcgatcaatactcggtcttccactgctcacaaatgatatatctgattcat |
301 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35084110 |
agatcatcattgttatacaatgaaggaaatattcgatcaatactcggtcttccactgctcacaaatgatatatctgattcat |
35084191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University