View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4073_low_20 (Length: 260)
Name: NF4073_low_20
Description: NF4073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4073_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 68 - 252
Target Start/End: Complemental strand, 3115170 - 3114986
Alignment:
| Q |
68 |
cagccaaggatatcttgcttggtggcaaaactgatgcatggaaggttccttcttcggaatctgattctctcaacaaatgggcttcaagtgttcgttttca |
167 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3115170 |
cagctaaggatatcttgcttggtggcaaaactgatgcatggaaggttccttcttcggaatctgattctctcaacaaatgggcttcaagtgttcgttttca |
3115071 |
T |
|
| Q |
168 |
agttggagaccatctaagtaattatcacttttcctttaatcttttcaatttttatcactaaaaattcaatttttatgttcatctc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
3115070 |
agttggagaccatctaagtaattatcacttttcctttaatcttttcaatttttatcactaaaatttcaatctttatgttcatctc |
3114986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University