View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4074_low_17 (Length: 266)
Name: NF4074_low_17
Description: NF4074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4074_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 51652990 - 51653227
Alignment:
| Q |
19 |
accatggcgaccgtgctgctgatctcctcgttgaattctttgagaaggtcaaggttgatccatctcactgggacaagatctctcaaggtggtctccaacg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51652990 |
accatggcgaccgtgctgctgatctcctcgttgaattctttgagaaggtcaaggttgatccatctcactgggacaagatctctcaaggtggtctccaacg |
51653089 |
T |
 |
| Q |
119 |
tattgaagagaagtaagctactataaccatgttacatagttttctttgcttaggttgtgtgaattgcgattaacttgttttattttttatgctttgcttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51653090 |
tattgaagagaagtaagctactataaccatgttacatagttttctttgcttaggttgtgtgaattgtgattaacttgttttattttttatgctttgcttc |
51653189 |
T |
 |
| Q |
219 |
caggtacacatggacaatttactctcagaggcttctta |
256 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51653190 |
caggtacacatggacaatatactctcagaggcttctta |
51653227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 135
Target Start/End: Complemental strand, 19152716 - 19152629
Alignment:
| Q |
48 |
gttgaattctttgagaaggtcaaggttgatccatctcactgggacaagatctctcaaggtggtctccaacgtattgaagagaagtaag |
135 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| | |||||||| |||||||| || |||||| |||||||| | |||||||||| |
|
|
| T |
19152716 |
gttgaattctttgagaagagtaaggctgatccatcttattgggacaaaatctctcatggaggtctcaaacgtattcatgagaagtaag |
19152629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University