View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4075_high_5 (Length: 207)
Name: NF4075_high_5
Description: NF4075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4075_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 52016914 - 52017116
Alignment:
| Q |
1 |
ctcaaacttctgcacaaaattcagctttgtgtatgcatttttacaggacgattggatcagatgagtcctctaccaactttcctggcaaaattccacaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52016914 |
ctcaaacttctgcacaaaattcag--ttgtgtattcatttttacaggacgattggatcagatgagtcctctaccaactttcctggcaaaattccacaggg |
52017011 |
T |
|
| Q |
101 |
ccttgaccttcccagtgatgttgctgacgagaaactttctggaagtgggccatcaaagtaac---attatcagcttttctcctgtcaacattgcaaggtg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || || ||||||||||||||||||||| |||| || |
|
|
| T |
52017012 |
ccttgaccttcccagtgatgttgctgacgagaaactttctgggagtgggccatcaaagtaacatgatgatgagcttttctcctgtcaacatttcaagatg |
52017111 |
T |
|
| Q |
198 |
atgat |
202 |
Q |
| |
|
||||| |
|
|
| T |
52017112 |
atgat |
52017116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University