View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4076_low_6 (Length: 337)
Name: NF4076_low_6
Description: NF4076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4076_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 75 - 321
Target Start/End: Complemental strand, 23862724 - 23862478
Alignment:
| Q |
75 |
tcatcaacaaactcatctttatgttaaacccaaaaattcagttgcagtaaattccacagacagagaagccacactaactacaagaatttctctctgaact |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23862724 |
tcatcaacaaactcatctttatgttaaacccaaaaattcagttgcagtaaattccacagacagagaagccacactaactacaagaatttctctctgaact |
23862625 |
T |
|
| Q |
175 |
actactatcaacctcttggattgcaacagtaacaacaagaaacctcttggaattagcaattgaatccatgtcttctcaaaacaagtaccaacatgaagat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23862624 |
actactatcaacctcttggattgcaacagtaacaacaagaaacctcttggaattagcaattgaatccatgtcttctcaaaacaagtaccaacatgaagat |
23862525 |
T |
|
| Q |
275 |
gactccatgtataaacttccgtaaatcagttgaatcaaacactttct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23862524 |
gactccatgtataaacttccgtaaatcagttgaatcaaacactttct |
23862478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University