View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4076_low_7 (Length: 327)
Name: NF4076_low_7
Description: NF4076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4076_low_7 |
 |  |
|
| [»] chr2 (20 HSPs) |
 |  |
|
| [»] scaffold0516 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (4 HSPs) |
 |  |  |
|
| [»] scaffold0517 (1 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 20)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 5 - 327
Target Start/End: Complemental strand, 23863238 - 23862916
Alignment:
| Q |
5 |
gagtgagatgaagtggtatcttttgaagatgtaaagcgtgcttgattagtatctgtctccttaagggtttacgtttaccgtaattcaaagttgcttaaca |
104 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23863238 |
gagtgaaaagaagtagtatcttttgaagatgtaaagcgtgcttgattagtatctgtctccttaagggtttacgtttaccgtaattcaaagttgcttaaca |
23863139 |
T |
 |
| Q |
105 |
acctgatcgaatagtggtgatatatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggtnnnnnnnnnnttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || || |
|
|
| T |
23863138 |
acctgatcgaatagtggtgatatatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttgatccctagtaaaaaaaaaaatt |
23863039 |
T |
 |
| Q |
205 |
gaaatccatccttgcaaaannnnnnnnnnnncaaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactg |
304 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23863038 |
gaaatccatccttgcaaaattttttgtttttcaaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgctgactg |
23862939 |
T |
 |
| Q |
305 |
tgcaaagtcagccacgtgtcatc |
327 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23862938 |
tgcaaagtcagccacgtgtcatc |
23862916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 36837834 - 36837780
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36837834 |
taaaatatatttttggtctctgcaaatatagcgagtttgggttttggtccctggt |
36837780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 1777471 - 1777526
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
1777471 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccctggt |
1777526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 2412485 - 2412430
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
2412485 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggt |
2412430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 23861754 - 23861809
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23861754 |
ctaaaatatgtttttggtccctgcaaatatggagagtttggattttggtccctggt |
23861809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 25977872 - 25977927
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25977872 |
ctaaaatatgtttttggtccctgcaaatatagtgagtttgggttttggtccctggt |
25977927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 25979308 - 25979253
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
25979308 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtccctggt |
25979253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 237 - 327
Target Start/End: Original strand, 11087154 - 11087244
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagtcagccacgtgtcatc |
327 |
Q |
| |
|
|||||||||| | |||||||||| ||||||||||||| |||| ||||| |||||| ||| |||||||| ||||| ||||||||||||| |
|
|
| T |
11087154 |
aaaatagtctcttgacccactttcttgctgatttgtctcatttttgcctgcgtggcaaatgctgactgtgtaaagttggccacgtgtcatc |
11087244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 135 - 191
Target Start/End: Complemental strand, 8810761 - 8810705
Alignment:
| Q |
135 |
actaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||| |||| |||||||| |
|
|
| T |
8810761 |
actaaaatatgtttttggtctctgcaaatatagcgaatttggattttaatccctggt |
8810705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 19604976 - 19604921
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
19604976 |
ctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccctggt |
19604921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 137 - 180
Target Start/End: Complemental strand, 24754214 - 24754171
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
24754214 |
taaaatatgtttttggtccctgcaaatatggcgaatttgggttt |
24754171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 25283329 - 25283274
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||| |||||| |||||||| |
|
|
| T |
25283329 |
ctaaaatatgtttttggtcactgcaaatatagcgaatttgagttttgatccctggt |
25283274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 8809598 - 8809654
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctct-gcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| || |||||||| ||| |||||||||||||||||||| |
|
|
| T |
8809598 |
ctaaaatatgtttttggtcccttgcaaatataacgaatttgggttttggtccctggt |
8809654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 184
Target Start/End: Original strand, 25282409 - 25282457
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggt |
184 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| |||||||| |||||||| |
|
|
| T |
25282409 |
ctaaaatatgtttttggtccctgtaaatatgtcgagtttgagttttggt |
25282457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 1137981 - 1138036
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| | |||| |||||||||||||| |
|
|
| T |
1137981 |
gactaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
1138036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 1778847 - 1778792
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
1778847 |
ctaaaatatgcttttggttcctgcaaatatagcgactttgggttttggtccttggt |
1778792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 30843646 - 30843701
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||| || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
30843646 |
ctaaaatatgcttttaatcactgcaaatataacgagtttgggttttggtccctggt |
30843701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 189
Target Start/End: Original strand, 146319 - 146381
Alignment:
| Q |
127 |
tatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||| |||||||||||| |||||||| ||||||||||| | |||| |||||| ||||||| |
|
|
| T |
146319 |
tatattagactaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 18113091 - 18113144
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| | ||||| |||||| ||||||| |
|
|
| T |
18113091 |
ctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 191
Target Start/End: Original strand, 21573936 - 21573993
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| | |||||| ||||||||| |||| |
|
|
| T |
21573936 |
gactaaaatatgcttttggtccctgcaaatatgacaagtttgatttttggtccttggt |
21573993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 8e-21; HSPs: 42)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 52401019 - 52401074
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52401019 |
ctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctggt |
52401074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 20489415 - 20489360
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20489415 |
ctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctggt |
20489360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 52403181 - 52403126
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52403181 |
ctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctggt |
52403126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 237 - 319
Target Start/End: Complemental strand, 42447743 - 42447661
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagtcagccac |
319 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| |||| |||||||||| || ||| |||||||| ||||| |||||| |
|
|
| T |
42447743 |
aaaatagtccttggacccactttcttgctgatttgtcccatttttgcctatgtgacagatgctgactgtgtaaagttagccac |
42447661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 134 - 191
Target Start/End: Original strand, 20488366 - 20488423
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
20488366 |
gactaaaatatgtttttggtccctgcaaatatggtgaatttgggttttggtccctggt |
20488423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 39820661 - 39820606
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39820661 |
ctaaaatatggttttggtccctgcaaatatagcgagtttgggttttggtccctggt |
39820606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 53121304 - 53121359
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
53121304 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggt |
53121359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 136 - 185
Target Start/End: Original strand, 42446528 - 42446577
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtc |
185 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42446528 |
ctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtc |
42446577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 131 - 191
Target Start/End: Original strand, 4705678 - 4705738
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||| |||||||||| ||||| || ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4705678 |
tttggctaaaatatgcttttgatccctgcaaatatggcgagtttaggttttggtccctggt |
4705738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 46026078 - 46026130
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| ||||||||||| |
|
|
| T |
46026078 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtccct |
46026130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 45267307 - 45267362
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
45267307 |
ctaaaatatgtttttgatccctgcaaatatagcgagtttgagttttggtccctggt |
45267362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 124 - 191
Target Start/End: Complemental strand, 47433878 - 47433811
Alignment:
| Q |
124 |
atatatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| | |||||||||| |||||||| |||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
47433878 |
atatatattaggctaaaatatggttttggtccctgcaaatatagcgaatttgagttttggtccctggt |
47433811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 48033060 - 48033115
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
48033060 |
ctaaaatatgtttttggtccttgcaaatatggtgagtttggattttggtccctggt |
48033115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 48035789 - 48035734
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
48035789 |
ctaaaatatgtttttgatccctgcaaatatgacgagtttggattttggtccctggt |
48035734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 52708674 - 52708619
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
52708674 |
ctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtctctggt |
52708619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 20585701 - 20585648
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||||| |||||||||||| |
|
|
| T |
20585701 |
ctaaaatatgtttttgatccctgcaaatatagcgagtttggattttggtccctg |
20585648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 185
Target Start/End: Original strand, 40476223 - 40476272
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtc |
185 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| |||||||| |
|
|
| T |
40476223 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtc |
40476272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 977900 - 977848
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
977900 |
aaatatgcttttggtccctgcaaatatgacgagtttgggttttggtccttggt |
977848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 40477431 - 40477379
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
40477431 |
ctaaaatatgattttggtccctgcaaatataacgagtttgggttttggtccct |
40477379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 54437524 - 54437472
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||| |||||||||||| |
|
|
| T |
54437524 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttggtccct |
54437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 187
Target Start/End: Complemental strand, 38505636 - 38505585
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccc |
187 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
38505636 |
ctaaaatatgcttttgctccctgcaaatatggcgagtttgagttttggtccc |
38505585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 137 - 180
Target Start/End: Original strand, 42444040 - 42444083
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
42444040 |
taaaatatgtttttggtccctgcaaatatggcaagtttgggttt |
42444083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 45268627 - 45268572
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| || |||||||||| || |||||||||||||||||||||| |
|
|
| T |
45268627 |
ctaaaatatgtttttaatccctgcaaatatagcaagtttgggttttggtccctggt |
45268572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 52707539 - 52707591
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| |||| ||||||||||||| |
|
|
| T |
52707539 |
taaaatatgtttttggtccttgcaaatatagcgaatttgagttttggtccctg |
52707591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 237 - 312
Target Start/End: Original strand, 3416594 - 3416669
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagt |
312 |
Q |
| |
|
|||||| || |||| |||||||| ||||| || |||| |||||||| ||||||||| |||||||||||| ||||| |
|
|
| T |
3416594 |
aaaataatcattgggcccacttttttgctcatgtgtctcatttatgcatatgtggcagatgttgactgtgtaaagt |
3416669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 32635596 - 32635651
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| ||||| ||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
32635596 |
ctaaaatatattttttgtccttgtaaatatagcgagtttgggttttggtccctggt |
32635651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 32637245 - 32637190
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||| |||| | |||||||||||||||||| |||||| |
|
|
| T |
32637245 |
ctaaaatatgcttttggtccctgtaaatgtagcgagtttgggttttggttcctggt |
32637190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 184
Target Start/End: Original strand, 37845408 - 37845455
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
37845408 |
taaaatatgtttttggtctctgcaaatatagtgagtttgtattttggt |
37845455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 39819314 - 39819369
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39819314 |
ctaaaatatggttttagtccctgcaaatatagcgagtttgaattttggtccctggt |
39819369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 43641145 - 43641200
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| |||||||||| || ||||||||||| |
|
|
| T |
43641145 |
ctaaaatatgcttttagtccctgcaaatatagcgagtttggattatggtccctggt |
43641200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 46027474 - 46027419
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
46027474 |
ctaaaatatacttttggtccctgcaaatatagcgagtttgaattttggtccctggt |
46027419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 187
Target Start/End: Original strand, 51004144 - 51004195
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccc |
187 |
Q |
| |
|
||||||||||||||| | | ||| ||||||||||| |||||||||||||||| |
|
|
| T |
51004144 |
ctaaaatatgtttttagaccctgtaaatatggcgaatttgggttttggtccc |
51004195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 287
Target Start/End: Original strand, 22508836 - 22508886
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctat |
287 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
22508836 |
aaaatagtctctggatccacttttttgctgatttgtcacatttatgcctat |
22508886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 251 - 293
Target Start/End: Original strand, 45267422 - 45267464
Alignment:
| Q |
251 |
acccactttattgctgatttgtccaatttatgcctatgtggca |
293 |
Q |
| |
|
||||||||| ||| ||||||||||||||| ||||||||||||| |
|
|
| T |
45267422 |
acccactttcttgatgatttgtccaatttttgcctatgtggca |
45267464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 50563867 - 50563813
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||||||| |||||||| ||||| |
|
|
| T |
50563867 |
taaaatatgtttttagtctctgaaaatataacgagtttggattttggtcgctggt |
50563813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 294
Target Start/End: Complemental strand, 20489315 - 20489258
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcat |
294 |
Q |
| |
|
|||||||| |||| ||||||||| || ||||||| | |||||||||||||||||||| |
|
|
| T |
20489315 |
aaaatagttattggccccactttactgatgatttggcaaatttatgcctatgtggcat |
20489258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 45002383 - 45002330
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
45002383 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
45002330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 189
Target Start/End: Original strand, 50196289 - 50196354
Alignment:
| Q |
124 |
atatatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||| ||||||||||| | |||| |||||| ||||||| |
|
|
| T |
50196289 |
atatttatttgactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 294
Target Start/End: Complemental strand, 52403079 - 52403022
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcat |
294 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||||||| |||| ||| |||||||||| |
|
|
| T |
52403079 |
aaaatagtccttggacccactttcttgatgatttgtcacatttgtgcatatgtggcat |
52403022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 136 - 172
Target Start/End: Complemental strand, 3417849 - 3417813
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagt |
172 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
3417849 |
ctaaaatatgtttttggtccctgtaaatatggcgagt |
3417813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 9855180 - 9855232
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||||||||| ||||| || ||| |||||| |||||||||| ||||||||||| |
|
|
| T |
9855180 |
ctaaaatatgattttgatccctgtaaatatagcgagtttggattttggtccct |
9855232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 134 - 166
Target Start/End: Original strand, 35533279 - 35533311
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatg |
166 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
35533279 |
gactaaaatatggttttggtctctgcaaatatg |
35533311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 41)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 24609921 - 24609973
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24609921 |
ctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccct |
24609973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 9774945 - 9774890
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9774945 |
ctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggt |
9774890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 27262910 - 27262965
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
27262910 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttgtgttttggtccctggt |
27262965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 27264273 - 27264218
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27264273 |
ctaaaatatgattttggtccctgcaaatatagcgagtttgggttttggtccctggt |
27264218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 39163081 - 39163026
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39163081 |
ctaaaatatgcttttggtccctgcaaatatggcgaggttgggttttggtccctggt |
39163026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 46075107 - 46075052
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46075107 |
ctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttggtccctggt |
46075052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 237 - 327
Target Start/End: Original strand, 30722219 - 30722309
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagtcagccacgtgtcatc |
327 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| |||| |||||| |||||| ||| |||||||| ||||| ||||||||||||| |
|
|
| T |
30722219 |
aaaatagtccctggacccactttcttgctgatttgtctcatttttgcctacgtggcaaatgctgactgtgtaaagttggccacgtgtcatc |
30722309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 131 - 189
Target Start/End: Original strand, 51240116 - 51240174
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||| ||||| |||||| |
|
|
| T |
51240116 |
tttgactaaaatatgtttttggtctctgcaaatatagcgaatttggattttgatccctg |
51240174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 48589018 - 48588965
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
48589018 |
ctaaaatatgtttttggtccctgtaaatatggtgagtttgggttttggtccctg |
48588965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 48594105 - 48594052
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
48594105 |
ctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttgatccctg |
48594052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 48598716 - 48598663
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
48598716 |
ctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttgatccctg |
48598663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 23470026 - 23469971
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
23470026 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttcggttttgatccctggt |
23469971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 24611174 - 24611119
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| |||||||| ||||||||||||||| |
|
|
| T |
24611174 |
ctaaaatatgtttttggtccctgtaaatatgacgagtttgagttttggtccctggt |
24611119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 35721103 - 35721158
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
35721103 |
ctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggtccctggt |
35721158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 37395635 - 37395690
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
37395635 |
ctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccctggt |
37395690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 47038868 - 47038923
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| ||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
47038868 |
ctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggt |
47038923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 50164405 - 50164460
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |||||||||| |||| |
|
|
| T |
50164405 |
ctaaaatatgcttttggtccctgcaaatatggcgagtttgagttttggtccttggt |
50164460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 9774040 - 9774094
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9774040 |
taaaatatgtttttggtccctgcaaatataacgagtttgagttttggtccctggt |
9774094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 237 - 310
Target Start/End: Original strand, 24422618 - 24422691
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaa |
310 |
Q |
| |
|
||||||||| || |||||||||| ||||| ||||||| |||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
24422618 |
aaaatagtccttagacccactttcttgctaatttgtctcatttctgcctatgtggcatatgctgactatgcaaa |
24422691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 127 - 191
Target Start/End: Original strand, 20722465 - 20722529
Alignment:
| Q |
127 |
tatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||| ||| ||||||| || |||||||| |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
20722465 |
tataattggctaaaatgtgcttttggtccctgcaaatatagcgaatttgggttttggtccctggt |
20722529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 11711310 - 11711256
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
11711310 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttggg-tttggtccctggt |
11711256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 13074631 - 13074576
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13074631 |
ctaaaatatatttttggttcctgcaaatatgacgagtttgagttttggtccctggt |
13074576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 20723745 - 20723690
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||| ||||| ||||||||| |
|
|
| T |
20723745 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttagtccctggt |
20723690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 24427426 - 24427371
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
24427426 |
ctaaaatatgtttttggtccctacaaatatagcgagtttgagttttagtccctggt |
24427371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 26863862 - 26863917
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| ||||||||||| |||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
26863862 |
ctaaaatgtgtttttggtccctgcaaatatagcgaatttgagttttggtccctggt |
26863917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 26865241 - 26865186
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| ||||| |||| ||||||||| |
|
|
| T |
26865241 |
ctaaaatatatttttggtctctgcaaatatagcgaatttggattttagtccctggt |
26865186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 136 - 182
Target Start/End: Complemental strand, 2604184 - 2604138
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttg |
182 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
2604184 |
ctaaaatatgtttttagtccctgcaaatatggggagtttgggttttg |
2604138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 17976766 - 17976818
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| ||||||| |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
17976766 |
aaatatggttttggttcctgcaaatatagcgaatttgggttttggtccctggt |
17976818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 17977613 - 17977561
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| |||||||| |||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
17977613 |
aaatatggttttggtccctgcaaatatagcgaatttgggttttggtccttggt |
17977561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 27816774 - 27816722
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| |||||||| |||||||||| || | |||||||||||||||||||| |
|
|
| T |
27816774 |
aaatatggttttggtccctgcaaatatagccaatttgggttttggtccctggt |
27816722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 11710555 - 11710610
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||||||| || ||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
11710555 |
ctaaaatatgtttttgatccctgtaaatataacgaggttgggttttggtccctggt |
11710610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 34934804 - 34934749
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
34934804 |
ctaaaatatgctttttgtccctgcaaatatagcgaatttgggttttggtccttggt |
34934749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 35722342 - 35722287
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||| ||||| |||||||| ||||| |
|
|
| T |
35722342 |
ctaaaatatgtttttggtccctgtaaatatagcgaatttggattttggtctctggt |
35722287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 183
Target Start/End: Complemental strand, 45979553 - 45979506
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttgg |
183 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| |||| ||||||| |
|
|
| T |
45979553 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttgg |
45979506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 306
Target Start/End: Complemental strand, 24611074 - 24611004
Alignment:
| Q |
236 |
caaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtg |
306 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||||||| |||| || |||||||||| || |||||||| |
|
|
| T |
24611074 |
caaaatagtccttggacccactttcttgatgatttgtctcatttttgtctatgtggcagctgctgactgtg |
24611004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 10631526 - 10631473
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||| |||||| ||||||| |
|
|
| T |
10631526 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Complemental strand, 13074532 - 13074483
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgccta |
286 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| | ||||||||||| |
|
|
| T |
13074532 |
aaaatagtctttggccccactttattgatgatttggcacatttatgccta |
13074483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 189
Target Start/End: Original strand, 35056520 - 35056585
Alignment:
| Q |
124 |
atatatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||| || |||||||||| |||||||| ||||||||||| | |||| |||||| ||||||| |
|
|
| T |
35056520 |
atatatatatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 27815446 - 27815498
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| || ||||| |||||||||| || | |||||||||||||||||||| |
|
|
| T |
27815446 |
aaatatggttctggtccctgcaaatatagccaatttgggttttggtccctggt |
27815498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 129 - 189
Target Start/End: Original strand, 31060782 - 31060842
Alignment:
| Q |
129 |
tatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||| |||||||||| |||||||| ||||||||||| | |||| |||||| ||||||| |
|
|
| T |
31060782 |
tatttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 39162825 - 39162881
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaata-tggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||| |||| |||||||| ||||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
39162825 |
ctaaattatgcttttggtccctgcaaataatggcgagtttggattttggtccttggt |
39162881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 36)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 35212070 - 35212125
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35212070 |
ctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctggt |
35212125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 24195609 - 24195664
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
24195609 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttgctccctggt |
24195664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 41693647 - 41693702
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41693647 |
ctaaaatatgtttttgatccctgcaaatatggcgaatttgggttttggtccctggt |
41693702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 135 - 191
Target Start/End: Complemental strand, 28462686 - 28462630
Alignment:
| Q |
135 |
actaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
28462686 |
actaaaatatgcttttggtctctgcaaatatgacgaatttgggttttgatccctggt |
28462630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 13418952 - 13419007
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
13418952 |
ctaaaatatgtttttggtccctgcaaatattgcgaatttgggtattggtccctggt |
13419007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 31848201 - 31848146
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
31848201 |
ctaaaatatgtttttagtccctgcaaatatagcgaatttgggttttggtccctggt |
31848146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 42254960 - 42255015
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
42254960 |
ctaaaatatgcttttggtccctgtaaatatggcgagtttgagttttggtccctggt |
42255015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 12385763 - 12385709
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||| |||||||||||||| |
|
|
| T |
12385763 |
taaaatatgattttggtccctgcaaatatagcgagtttggattttggtccctggt |
12385709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 136 - 186
Target Start/End: Complemental strand, 31489992 - 31489942
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtcc |
186 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
31489992 |
ctaaaatatgtttttggtccctgcaaatataacgagtttgggttttggtcc |
31489942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 237 - 327
Target Start/End: Original strand, 37784083 - 37784173
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagtcagccacgtgtcatc |
327 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||| ||| ||||||||||||| ||||||| |||| ||||| ||||| ||||||| |
|
|
| T |
37784083 |
aaaatagtccttggaccaactttcttgctgatttgtctcattcctgcctatgtggcagatgttgattgtgtaaagttggccacatgtcatc |
37784173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 137 - 187
Target Start/End: Original strand, 38742184 - 38742234
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccc |
187 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
38742184 |
taaaatatgtttttagtccctgcaaatatagcgagtttgggttttggtccc |
38742234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 237 - 302
Target Start/End: Original strand, 36748300 - 36748365
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgac |
302 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| |||| ||||||||||||| ||| |||| |
|
|
| T |
36748300 |
aaaatagtctctggacccacttttttgctgatttgtctcatttttgcctatgtggcagatgctgac |
36748365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 5611564 - 5611512
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
5611564 |
ctaaaatatgattttggtccctgcaaatatagcgagtttgggttttcgtccct |
5611512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 31853550 - 31853602
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||| | |||||||| ||||||||||| |
|
|
| T |
31853550 |
ctaaaatatgtttttggtccctgcaaatattgtgagtttggattttggtccct |
31853602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 131 - 187
Target Start/End: Original strand, 36748195 - 36748250
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccc |
187 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
36748195 |
tttggctaaaatatgtttttggtccctgcaaatat-gagagtttgggttttggtccc |
36748250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 36749304 - 36749252
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
36749304 |
ctaaaatatgtttttggtcattgcaaatatgacgagtttgagttttggtccct |
36749252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 39618661 - 39618712
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||| ||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
39618661 |
aaatatgtttttg-tctatgcaaaaatggcgagtttgggttttggtccctggt |
39618712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 184
Target Start/End: Complemental strand, 39619848 - 39619800
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggt |
184 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39619848 |
ctaaaatatgcttttggtccatgcaaatatggcgagtttgggttttggt |
39619800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 17066427 - 17066482
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17066427 |
ctaaaatatgcttttaatccctgcaaatatagcgagtttgggttttggtccctggt |
17066482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 32197966 - 32197911
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
32197966 |
ctaaaatatgcttttggtccctgcaaatatagcgaatttgggttttggtccttggt |
32197911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 41695012 - 41694957
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
41695012 |
ctaaaatatgtttttcatccctgcaaatatagcgagtttgagttttggtccctggt |
41694957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 11217127 - 11217073
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11217127 |
taaaatatgcttttggtccctgcaaatatagcgagtttgaattttggtccctggt |
11217073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 319
Target Start/End: Complemental strand, 32544730 - 32544648
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagtcagccac |
319 |
Q |
| |
|
||||||||| |||| | ||||| |||||||||||| ||||| ||||||||||||| ||| ||||| |||||||||| |||| |
|
|
| T |
32544730 |
aaaatagtcattgggtctactttcttgctgatttgtttaatttttgcctatgtggcagatgatgactatgcaaagtcaaccac |
32544648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 32544830 - 32544776
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
32544830 |
taaaatatgattttggtccctgcaaatatagcgaatttgggttttggtccttggt |
32544776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 32196686 - 32196739
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||| |||||||||||| |
|
|
| T |
32196686 |
ctaaaatatgtttttggtccctgcaaatatagcgtatttggattttggtccctg |
32196739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 293
Target Start/End: Original strand, 42255061 - 42255117
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggca |
293 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||| |||| ||| ||||||||| |
|
|
| T |
42255061 |
aaaatagtcattggatccactttcttgctgatttgtcccatttctgcatatgtggca |
42255117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 187
Target Start/End: Original strand, 554247 - 554298
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccc |
187 |
Q |
| |
|
||||||||| | |||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
554247 |
ctaaaatataatattggtccctgcaaatatagcgagtttgggttttggtccc |
554298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 12933421 - 12933476
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| | ||||||| |||||||||||||| |
|
|
| T |
12933421 |
ctaaaatatgcttttggtccctgcaaatatagtgagtttgaattttggtccctggt |
12933476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 25046297 - 25046242
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| | ||||||||| |||| |
|
|
| T |
25046297 |
ctaaaatatgattttggtccttgcaaatatggcgagtttagattttggtccatggt |
25046242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 251 - 310
Target Start/End: Complemental strand, 31489878 - 31489819
Alignment:
| Q |
251 |
acccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaa |
310 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||||||||||||||| | ||| |||||| |
|
|
| T |
31489878 |
acccactttcttgctgatttgtctcatttttgcctatgtggcatatgctaactctgcaaa |
31489819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 40576768 - 40576823
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||| ||||| |||||||| ||||| |
|
|
| T |
40576768 |
ctaaaatatgcttttggtccctgcaaatatgacgaatttggattttggtctctggt |
40576823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 148 - 191
Target Start/End: Complemental strand, 42255947 - 42255904
Alignment:
| Q |
148 |
tttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42255947 |
tttggtccctgcaaatatgacgagtttgagttttggtccctggt |
42255904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 140 - 191
Target Start/End: Complemental strand, 43869965 - 43869914
Alignment:
| Q |
140 |
aatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||| |||||||| |||||||||| || | |||||||||||||||||||| |
|
|
| T |
43869965 |
aatatggttttggtccctgcaaatatagccaatttgggttttggtccctggt |
43869914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 25037755 - 25037807
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| |||| ||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
25037755 |
aaatatgattttagtccctgcaaatatgacgagtttgaattttggtccctggt |
25037807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 293
Target Start/End: Complemental strand, 36749203 - 36749147
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggca |
293 |
Q |
| |
|
||||||||||||||| ||||||| | ||||||||||| |||| ||| ||||||||| |
|
|
| T |
36749203 |
aaaatagtctttggatccactttctcgctgatttgtctcatttctgcatatgtggca |
36749147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 293
Target Start/End: Original strand, 39618758 - 39618814
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggca |
293 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||||||| |||| || |||||||||| |
|
|
| T |
39618758 |
aaaatagtccttggacccactttcttgatgatttgtcttatttttgtctatgtggca |
39618814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 25)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 17516162 - 17516217
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
17516162 |
gactaaaatatgtttttggtccctgcaaatatggtgagtttgggttttggtccctg |
17516217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 17517366 - 17517311
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17517366 |
ctaaaatatgtttttggtccctgcaaatatggcgagtttgagttttggtccctggt |
17517311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 29291361 - 29291414
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29291361 |
ctaaaatatgcttttggtccttgcaaatatggcgagtttgggttttggtccctg |
29291414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 18810534 - 18810589
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18810534 |
ctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctggt |
18810589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 21165248 - 21165303
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
21165248 |
ctaaaatatgcttttggtccctgcaaatatagcgagtttgtgttttggtccctggt |
21165303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 34998198 - 34998143
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| ||||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34998198 |
ctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctggt |
34998143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 127 - 191
Target Start/End: Complemental strand, 20897563 - 20897499
Alignment:
| Q |
127 |
tatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||| ||| |||||||||| |||||||| |||||||||| | || |||||||||||||||||||| |
|
|
| T |
20897563 |
tataattggctaaaatatggttttggtccctgcaaatatagtgaatttgggttttggtccctggt |
20897499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 16995453 - 16995508
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
16995453 |
ctaaaatatgtttttggtccctgcaaatataaagaatttgggttttggtccctggt |
16995508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 21953208 - 21953263
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
21953208 |
ctaaaatatgcttttggtccctgcaaatatagcgaatttggattttggtccctggt |
21953263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 26421900 - 26421845
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |||| ||||| ||||||||| |
|
|
| T |
26421900 |
ctaaaacatgtttttggtctctgcaaatatagcgaatttgagttttagtccctggt |
26421845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 241 - 319
Target Start/End: Complemental strand, 26421795 - 26421717
Alignment:
| Q |
241 |
tagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagtcagccac |
319 |
Q |
| |
|
||||| ||||| ||||||| ||||||||||||| |||| ||||||||| ||| ||| ||||| |||||||||| |||| |
|
|
| T |
26421795 |
tagtcattggatccactttcttgctgatttgtctcatttttgcctatgtagcagatgatgactatgcaaagtcaaccac |
26421717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 191
Target Start/End: Complemental strand, 25440732 - 25440675
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
25440732 |
gactaaaatatatttttggtccttacaaatatggcgagtttgaattttggtccctggt |
25440675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 137 - 189
Target Start/End: Complemental strand, 1171707 - 1171655
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| |||||||||||| |
|
|
| T |
1171707 |
taaaatatgtttttgatccctgcaaatataacgagtttggtttttggtccctg |
1171655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 191
Target Start/End: Original strand, 1972397 - 1972457
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| |||| |||||||||| ||| ||||| |
|
|
| T |
1972397 |
tttggctaaaatatgtttttggtccctgcaaataaagcgaatttgggttttagtctctggt |
1972457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 3276369 - 3276421
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||| |||| |||||| |
|
|
| T |
3276369 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttggattttagtccct |
3276421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 13617529 - 13617584
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| |||| |||||| ||||||| |
|
|
| T |
13617529 |
gactaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 130 - 189
Target Start/End: Complemental strand, 17000340 - 17000281
Alignment:
| Q |
130 |
atttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||| | | ||||||||||||||||||||| |
|
|
| T |
17000340 |
atttggctaaaatatacttttggtccctgcaaatgtagtgagtttgggttttggtccctg |
17000281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 20391217 - 20391268
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||| |||||||| |||||||||| | || ||||||||||||||||| |
|
|
| T |
20391217 |
taaaatatgcttttggtccctgcaaatatagtgaatttgggttttggtccct |
20391268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 134 - 181
Target Start/End: Original strand, 20895958 - 20896005
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggtttt |
181 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| |||| ||||| |
|
|
| T |
20895958 |
gactaaaatatgtttttggtccctgcaaatatagcgaatttgagtttt |
20896005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 134 - 185
Target Start/End: Complemental strand, 30253598 - 30253547
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtc |
185 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||| || ||||||||| |
|
|
| T |
30253598 |
gactaaaatatgtttttggtccctgcaaatacagcgagtatgagttttggtc |
30253547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 3279555 - 3279501
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
3279555 |
taaaatatgtttttgatccctgcaaatatagcgagtttgaattttggttcctggt |
3279501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 25439646 - 25439696
Alignment:
| Q |
132 |
ttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttg |
182 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||| ||||||||||| |
|
|
| T |
25439646 |
ttgactaaaatatgtttttagtccctgcaaatataacgattttgggttttg |
25439696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 1974209 - 1974156
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||| |||| ||||||||||||| |
|
|
| T |
1974209 |
ctaaaatatgtttttgatccttgcaaatatagcgaatttgagttttggtccctg |
1974156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 294
Target Start/End: Original strand, 17516265 - 17516322
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcat |
294 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||||||| |||| ||| |||||||||| |
|
|
| T |
17516265 |
aaaatagtccttggacccactttcttgatgatttgtcacatttgtgcatatgtggcat |
17516322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 31198617 - 31198670
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||| |||||| ||||||| |
|
|
| T |
31198617 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 20)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 3936580 - 3936635
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3936580 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccctggt |
3936635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 134 - 188
Target Start/End: Complemental strand, 15604116 - 15604063
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15604116 |
gactaaaatgtgtttttggtc-ctgcaaatatggcgagtttgggttttggtccct |
15604063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 4565395 - 4565450
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| ||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
4565395 |
ctaaaatatgtttttagtccctacaaatatagcgagtttgggttttggtccctggt |
4565450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 6894067 - 6894012
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |||||||||||||||| |
|
|
| T |
6894067 |
ctaaaatatgtttttggtccttgcaaatatgacgagtttaggttttggtccctggt |
6894012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 27571186 - 27571131
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27571186 |
ctaaaatatgattttggtccctgcaaatatagcgagtttgggttttgatccctggt |
27571131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 134 - 191
Target Start/End: Complemental strand, 3205161 - 3205104
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3205161 |
gactaaaatatgcttttgatccctgcaaatatgatgagtttgggttttggtccctggt |
3205104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 3954054 - 3954109
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| |||||||||||||||||||| |
|
|
| T |
3954054 |
ctaaaatatgtttttggtccttgcaaatatatcgaatttgggttttggtccctggt |
3954109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 187
Target Start/End: Original strand, 15599767 - 15599818
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccc |
187 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
15599767 |
ctaaaatatgcttttggtccctacaaatatggcgaatttgggttttggtccc |
15599818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 31540498 - 31540553
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
31540498 |
ctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggtacctggt |
31540553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 237 - 310
Target Start/End: Original strand, 4777743 - 4777816
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaa |
310 |
Q |
| |
|
||||||||| || |||||||||| |||| ||||||||||||| || |||| ||||| |||||||| ||||||| |
|
|
| T |
4777743 |
aaaatagtccttagacccacttttgtgctaatttgtccaatttttgtctatatggcaaatgttgaccgtgcaaa |
4777816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 3938117 - 3938062
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| || ||||| |||||||||||||||| |
|
|
| T |
3938117 |
ctaaaatatgcttttagtccctgcaaatatagcaagtttaggttttggtccctggt |
3938062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 131 - 174
Target Start/End: Original strand, 25252638 - 25252681
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagttt |
174 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
25252638 |
tttggctaaaatatgtttttgatctctgcaaatatagcgagttt |
25252681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 131 - 174
Target Start/End: Original strand, 25316423 - 25316466
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagttt |
174 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
25316423 |
tttggctaaaatatgtttttgatctctgcaaatatagcgagttt |
25316466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 187
Target Start/End: Original strand, 27570058 - 27570109
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccc |
187 |
Q |
| |
|
|||||||||| |||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
27570058 |
ctaaaatatgattttggtccttgcaaatatagcgagtttgggttttgttccc |
27570109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 182
Target Start/End: Original strand, 35604421 - 35604467
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttg |
182 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
35604421 |
ctaaaatatgtttttggtttctgcaaatataacgagtttgagttttg |
35604467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 294
Target Start/End: Complemental strand, 3205060 - 3205003
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcat |
294 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||| | ||||||||||| ||||||| |
|
|
| T |
3205060 |
aaaatagtcattggccccactttattgttgatttggcacatttatgcctacgtggcat |
3205003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 223
Target Start/End: Original strand, 14809165 - 14809252
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggtnnnnnnnnnntttgaaatccatccttgcaaaa |
223 |
Q |
| |
|
|||||||||||||||| || || ||||||| |||| ||||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
14809165 |
ctaaaatatgtttttgatccctacaaatatagcgaatttggattttggtccctagtagaaataaattttgaaatccatccttgcaaaa |
14809252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 37271361 - 37271414
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
37271361 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
37271414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 135 - 191
Target Start/End: Complemental strand, 25254189 - 25254133
Alignment:
| Q |
135 |
actaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||| |||||| |||||||| |
|
|
| T |
25254189 |
actaaaatatgcttttggtccctgcaaatatatagagtttgagttttgatccctggt |
25254133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 135 - 191
Target Start/End: Complemental strand, 25317979 - 25317923
Alignment:
| Q |
135 |
actaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||| |||||| |||||||| |
|
|
| T |
25317979 |
actaaaatatgcttttggtccctgcaaatatatagagtttgagttttgatccctggt |
25317923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0516 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0516
Description:
Target: scaffold0516; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 136 - 223
Target Start/End: Complemental strand, 1192 - 1105
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggtnnnnnnnnnntttgaaatccatccttgcaaaa |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
1192 |
ctaaaatatatttttggtctctgcaaatatggcgagtttgagttttggtccctcgtaaattttttttttgaaatccatccttgcaaaa |
1105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 34)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 131 - 188
Target Start/End: Complemental strand, 28998055 - 28997998
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28998055 |
tttggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccct |
28997998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 14197827 - 14197879
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
14197827 |
ctaaaatatgtttttggtccctgcaaatatggcgagtttggattttggtccct |
14197879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 134 - 189
Target Start/End: Original strand, 3483633 - 3483688
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3483633 |
gactaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccctg |
3483688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 10717123 - 10717178
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10717123 |
ctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggt |
10717178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 10718505 - 10718450
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10718505 |
ctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggt |
10718450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 22534779 - 22534724
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| ||||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22534779 |
ctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctggt |
22534724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 28996836 - 28996891
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
28996836 |
ctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctggt |
28996891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 36588224 - 36588279
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
36588224 |
ctaaaatatgcttttggtccctgcaaatatagcgagtttgcgttttggtccctggt |
36588279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 45518017 - 45517962
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
45518017 |
ctaaaatatgcttttggtccctgcaagtatagcgagtttgggttttggtccctggt |
45517962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 1420499 - 1420446
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| | |||||||||| |
|
|
| T |
1420499 |
ctaaaatatgtttttggtccctgcaaatatagcgagtttggatattggtccctg |
1420446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 237 - 294
Target Start/End: Original strand, 38658583 - 38658640
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcat |
294 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
38658583 |
aaaatagtctttggccccactttattgatgatttggcacatttatgcctatgtggcat |
38658640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 39440479 - 39440426
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
39440479 |
ctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtccctg |
39440426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 4182624 - 4182679
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
4182624 |
ctaaaatatgcttttggtccctgtaaatatagcgaatttgggttttggtccctggt |
4182679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 252 - 327
Target Start/End: Original strand, 18326629 - 18326704
Alignment:
| Q |
252 |
cccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagtcagccacgtgtcatc |
327 |
Q |
| |
|
|||||||| ||| |||||||||| |||| ||||||||||||| ||||||| |||| || || ||||||||||||| |
|
|
| T |
18326629 |
cccactttcttgttgatttgtcccatttctgcctatgtggcagatgttgattgtgtaatgttggccacgtgtcatc |
18326704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 22272327 - 22272272
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| | |||||||| |||| |||||||||||||||||||| |
|
|
| T |
22272327 |
ctaaaatatgcttttggtccccgcaaatatagcgaatttgggttttggtccctggt |
22272272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 22533319 - 22533374
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
22533319 |
ctaaaatatgcttttggtccctgtatatatagcgagtttgggttttggtccctggt |
22533374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 129 - 188
Target Start/End: Original strand, 38455442 - 38455501
Alignment:
| Q |
129 |
tatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | || |||| |||||||||||| |
|
|
| T |
38455442 |
tatttgactaaaatatgtttttggtccttgcaaatatagtgaatttgagttttggtccct |
38455501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 39439926 - 39439981
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
39439926 |
ctaaaatatgattttggtccctgcaaatatggctagtttgagttttggaccctggt |
39439981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 130 - 191
Target Start/End: Complemental strand, 4184042 - 4183981
Alignment:
| Q |
130 |
atttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||| |||||||||| |||| ||| |||||||||| | | ||||||||||||||||||||| |
|
|
| T |
4184042 |
atttggctaaaatatgcttttagtccctgcaaatatagtgcgtttgggttttggtccctggt |
4183981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 253 - 310
Target Start/End: Original strand, 14711651 - 14711708
Alignment:
| Q |
253 |
ccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaa |
310 |
Q |
| |
|
||||||| |||| ||||||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
14711651 |
ccacttttgtgctaatttgtccaatttttgcctatgtggcaaatgttgaccgtgcaaa |
14711708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 41847237 - 41847184
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||| |||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
41847237 |
ctaaaatatgcttttagtctctgcaaatatagcgaatttgagttttggtccctg |
41847184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 3031600 - 3031545
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
3031600 |
ctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccctggt |
3031545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 30124280 - 30124225
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||||||||| || |||||| ||||||||||||||| |
|
|
| T |
30124280 |
ctaaaatatgcttttggtccctgcaaataaagcaagtttgagttttggtccctggt |
30124225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 38456787 - 38456732
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| || | ||| |||||||||||||||| |
|
|
| T |
38456787 |
ctaaaatatgcttttggtccctgcaaatatagcaaatttaggttttggtccctggt |
38456732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 38658483 - 38658538
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| || ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
38658483 |
ctaaaatatgcttctggtccatgcaaatatagcgaatttgggttttggtccctggt |
38658538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 184
Target Start/End: Complemental strand, 41357422 - 41357375
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggt |
184 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
41357422 |
taaaatatgtttttggtcctcgcaaatatggtgagtttgggttttggt |
41357375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 186
Target Start/End: Original strand, 6783580 - 6783630
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtcc |
186 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || |||| ||||||||| |
|
|
| T |
6783580 |
ctaaaatatgtttttggtcactgcaaatatggtgaatttgaattttggtcc |
6783630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 131 - 189
Target Start/End: Complemental strand, 10873283 - 10873225
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
10873283 |
tttggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 291
Target Start/End: Complemental strand, 30124177 - 30124123
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtgg |
291 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||| | |||||||||| |||||| |
|
|
| T |
30124177 |
aaaatagtcattggccccactttattgatgatttgacaaatttatgcccatgtgg |
30124123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 20984148 - 20984201
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||| |||||| ||||||| |
|
|
| T |
20984148 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 191
Target Start/End: Original strand, 45516397 - 45516454
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||| ||| || |||||| |||| |||||||||||||| ||||| |
|
|
| T |
45516397 |
gactaaaatatgtttttagtccatgtaaatatagcgaatttgggttttggtctctggt |
45516454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 1376940 - 1376992
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| |||||||| |||||||||| || | ||||| |||||||||||||| |
|
|
| T |
1376940 |
aaatatgattttggtccctgcaaatatagccaatttggattttggtccctggt |
1376992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 1385609 - 1385557
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| |||||||| |||||||||| || | ||||| |||||||||||||| |
|
|
| T |
1385609 |
aaatatggttttggtccctgcaaatatagccaatttggattttggtccctggt |
1385557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 34963669 - 34963609
Alignment:
| Q |
129 |
tatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||| |||||||||| |||||||| ||||||||||| | |||| |||||| ||||||| |
|
|
| T |
34963669 |
tatttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 34)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 130 - 191
Target Start/End: Original strand, 22204051 - 22204112
Alignment:
| Q |
130 |
atttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
22204051 |
atttggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggt |
22204112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 131 - 191
Target Start/End: Complemental strand, 42359408 - 42359348
Alignment:
| Q |
131 |
tttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||||| |||||||||||||| |
|
|
| T |
42359408 |
tttggctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtccctggt |
42359348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 136 - 186
Target Start/End: Original strand, 41933820 - 41933870
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtcc |
186 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41933820 |
ctaaaatatgattttggtctctgcaaatatagcgagtttgggttttggtcc |
41933870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 136 - 223
Target Start/End: Complemental strand, 33137285 - 33137198
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggtnnnnnnnnnntttgaaatccatccttgcaaaa |
223 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
33137285 |
ctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccctggtaaaaattttttttgaaatccatccttgcaaaa |
33137198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 3880553 - 3880501
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
3880553 |
ctaaaatatgtttttggttcctgcaaatatagcgagtttgggttttggtccct |
3880501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 32699371 - 32699319
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
32699371 |
ctaaaatatgtttttggtccctgtaaatatagcgagtttgggttttggtccct |
32699319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 294
Target Start/End: Original strand, 16573380 - 16573537
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggtnnnnnnnnnntttgaaatccatccttgcaaaannnnnnnnnnnn |
235 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||||||||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
16573380 |
ctaaaatatgcttttggtctctacaaatatggcgaatttgggttttggtctctggtatttttttt-tttgaaatccatccctgcaaaattttttgttttt |
16573478 |
T |
 |
| Q |
236 |
caaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcat |
294 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| | ||||||||||| ||||||| |
|
|
| T |
16573479 |
taaaatagtctttggccccactttattgatgatttggcacatttatgcctacgtggcat |
16573537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 237 - 312
Target Start/End: Original strand, 29415654 - 29415729
Alignment:
| Q |
237 |
aaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagt |
312 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||||| |||| || |||||||||| ||| |||||||| ||||| |
|
|
| T |
29415654 |
aaaatagtccttggacccaccttcttgctgatttgtcctatttctgtctatgtggcagatgctgactgtgtaaagt |
29415729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 45618287 - 45618342
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||| ||||| |||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45618287 |
ctaatatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggt |
45618342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 54121757 - 54121702
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| ||||| || ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54121757 |
ctaaaatatgattttgctccctgcaaatacggcgagtttgggttttggtccctggt |
54121702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 34659708 - 34659761
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
34659708 |
ctaaaatatgcttttggtccctgcaaatatggcgagttaaggttttggtccctg |
34659761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 137 - 185
Target Start/End: Complemental strand, 41935126 - 41935078
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtc |
185 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
41935126 |
taaaatatgtttttggtccctgcaaatataacgagtttgggttttggtc |
41935078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 184
Target Start/End: Original strand, 44705301 - 44705349
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
44705301 |
ctaaaatatgtttttggtctctgcaaatatagtgaatttgggttttggt |
44705349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 3879088 - 3879143
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| ||||| || |||||||||| |||||||||| |||||||||||||| |
|
|
| T |
3879088 |
ctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccctggt |
3879143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 19674416 - 19674471
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
19674416 |
ctaaaatatgcttttggtccttgcaaatatagcgagtttgagttttggtccctggt |
19674471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 45619788 - 45619733
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
45619788 |
ctaaaatatgtttttagtccctgcaaatatagcgagtttaggttttgttccctggt |
45619733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 173
Target Start/End: Complemental strand, 5259208 - 5259171
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtt |
173 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5259208 |
ctaaaatatgtttttggtccctgcaaatatggcgagtt |
5259171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 19675677 - 19675624
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
19675677 |
ctaaaatatgcttttggtccctgcaaatataacgagtttggattttggtccctg |
19675624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 189
Target Start/End: Complemental strand, 26412594 - 26412529
Alignment:
| Q |
124 |
atatatatttgactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||| |||| |||||||||| |||||||| ||||||||||||| |||| |||||| ||||||| |
|
|
| T |
26412594 |
atatatttttggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 33134893 - 33134945
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||| | ||||||||| |
|
|
| T |
33134893 |
ctaaaatatgtttttgatccctgcaaatatgacgagtttggatattggtccct |
33134945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 54120759 - 54120811
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||| ||| ||||||| ||||||||| |||||||| |||||| |
|
|
| T |
54120759 |
aaatatgtttttggtttcttcaaatatagcgagtttgagttttggttcctggt |
54120811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 134 - 185
Target Start/End: Original strand, 16916067 - 16916118
Alignment:
| Q |
134 |
gactaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtc |
185 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
16916067 |
gactaaaatatacttttggtccctgcaaatatggtgagtttgagttttggtc |
16916118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 156 - 191
Target Start/End: Original strand, 40198596 - 40198631
Alignment:
| Q |
156 |
ctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40198596 |
ctgcaaatatagcgagtttgggttttggtccctggt |
40198631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 42358034 - 42358089
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| | |||||| |||||| |||||||| |
|
|
| T |
42358034 |
ctaaaatatgtttttggtccctgcaaatataggaagtttgagttttgatccctggt |
42358089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 190
Target Start/End: Original strand, 4211563 - 4211617
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctgg |
190 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| | |||| ||||||||||||||| |
|
|
| T |
4211563 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
4211617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 17371901 - 17371847
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||| ||||| || |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
17371901 |
taaaatatgcttttgatccctgcaaatataacgaatttgggttttggtccctggt |
17371847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 12152491 - 12152438
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| | |||| |||||||||||||| |
|
|
| T |
12152491 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
12152438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 14487804 - 14487857
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| | |||| |||||||||||||| |
|
|
| T |
14487804 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
14487857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 46292394 - 46292447
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| | |||| |||||||||||||| |
|
|
| T |
46292394 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 137 - 189
Target Start/End: Original strand, 5797484 - 5797536
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 312
Target Start/End: Complemental strand, 29060826 - 29060762
Alignment:
| Q |
248 |
tggacccactttattgctgatttgtccaatttatgcctatgtggcatatgttgactgtgcaaagt |
312 |
Q |
| |
|
|||||||||||| |||||||||| || |||| |||||| |||||| ||| |||||||| ||||| |
|
|
| T |
29060826 |
tggacccactttcttgctgatttatctcatttttgcctacgtggcaaatgctgactgtgtaaagt |
29060762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 35054665 - 35054713
Alignment:
| Q |
137 |
taaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtc |
185 |
Q |
| |
|
||||||||| |||| ||| |||||||||| |||| |||||||||||||| |
|
|
| T |
35054665 |
taaaatatgattttagtccctgcaaatatagcgaatttgggttttggtc |
35054713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 136 - 184
Target Start/End: Original strand, 38166497 - 38166545
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggt |
184 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||| ||||||| |
|
|
| T |
38166497 |
ctaaaatatgtttttaatccctgcaaatatagcgagtttggattttggt |
38166545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 191
Target Start/End: Complemental strand, 44706410 - 44706366
Alignment:
| Q |
147 |
ttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
44706410 |
ttttggtcactgtaaatatgacgagtttgggttttgatccctggt |
44706366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 45; Significance: 1e-16; HSPs: 4)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 344942 - 344994
Alignment:
| Q |
139 |
aaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
344942 |
aaatatgattttggtccctgcaaatatggcgagtttgggttttggtccctggt |
344994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 345954 - 345902
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
345954 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtccct |
345902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 374337 - 374389
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccct |
188 |
Q |
| |
|
|||||||||| ||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
374337 |
ctaaaatatgattttgatccctgcaaatatagcgagtttgggttttggtccct |
374389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 136 - 181
Target Start/End: Complemental strand, 376426 - 376381
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggtttt |
181 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
376426 |
ctaaaatatgcttttggtccctgcaaatatagcgagtttgggtttt |
376381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 11579 - 11524
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
11579 |
ctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccctggt |
11524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 488 - 433
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
488 |
ctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccctggt |
433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 30964 - 30909
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
30964 |
ctaaaatatggttttggtccctgcaaatatagtgagtttgggttttggtccctggt |
30909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 29731 - 29786
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29731 |
ctaaaatatgcttttggtccctgcaaataaaacgagtttggattttggtccctggt |
29786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 136 - 191
Target Start/End: Complemental strand, 121042 - 120987
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
121042 |
ctaaaatatgcttttggtccctgcaaatataacgagtttgggttttggtccctggt |
120987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 119595 - 119650
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
119595 |
ctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccctggt |
119650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 42812 - 42759
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctg |
189 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
42812 |
ctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtccctg |
42759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 191
Target Start/End: Original strand, 9924 - 9979
Alignment:
| Q |
136 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttggtccctggt |
191 |
Q |
| |
|
|||||||||| ||||| || |||||||||| |||||||||| |||||||||||||| |
|
|
| T |
9924 |
ctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccctggt |
9979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University