View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4076_low_9 (Length: 324)
Name: NF4076_low_9
Description: NF4076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4076_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 140 - 309
Target Start/End: Complemental strand, 38481246 - 38481075
Alignment:
| Q |
140 |
cgcttctgcctctttcattttcaacaactcaggtttttaattcatccatcttccttctcctcaatttgcttattccattttcttatctcgaataggtctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38481246 |
cgcttctgcctctttcattttcaacaactcaggtttttaattcatccatcttccttctcctcaatttgcttattccattttcttctctcgaataggtcta |
38481147 |
T |
|
| Q |
240 |
ttagacccttaagttggtccctatatttatcatcaattaggtctc--tattttaacaacttacactcgtttt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38481146 |
ttagacccttaagttggtccctatatttatcatcaattaggtctctatattttaacaacttacactcgtttt |
38481075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University