View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4078_high_4 (Length: 315)
Name: NF4078_high_4
Description: NF4078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4078_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 5 - 171
Target Start/End: Complemental strand, 44471954 - 44471788
Alignment:
| Q |
5 |
gagaagcataggcaatgacactgtgacagtagaacttccaaatttcgaactaggcagaagaatagcgatgggataggtcataaaaaatgatatatcccaa |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44471954 |
gagaatcataggcaatgacactgtgacagtagaacttccaaatttcgaactaggcagaagaatagcgatgggataggtcataaaaaatgatatatcccaa |
44471855 |
T |
|
| Q |
105 |
tttaaaatttacaggtttcaggttgaaaaagagagaagggattttgaataaatggtcggcatatgaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44471854 |
tttaaaatttacaggtttcaggttgaaaaagagagaagagattttgaataaatggtcggcatatgaa |
44471788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 162 - 315
Target Start/End: Complemental strand, 52720567 - 52720410
Alignment:
| Q |
162 |
ggcatatgaataattttgatcgatacgaactcaatatgggtaactctatccaccttttgttgatgggtaggtaataatttgctttcctttttaaattaat |
261 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52720567 |
ggcatatgaatgattttgattgatgcgaactcaatatgggtaactctatccacctttcgttgatgggtaggtaataatttgctttcctttttaaattaat |
52720468 |
T |
|
| Q |
262 |
cctata----cggtgcttgttgatcctcatatcatcttgattaaattataaggaacct |
315 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52720467 |
cctatacgcgcggtgcttgttgatcctcatatcatcttgattaaattataaggaacct |
52720410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University