View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4078_low_2 (Length: 359)
Name: NF4078_low_2
Description: NF4078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4078_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 52722325 - 52722159
Alignment:
| Q |
1 |
attatccatgcatgttaattaatcttacaattaattaatgtagaaagaacccacgtattctttatttgcggtaactacattacccatcaacaaaagatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722325 |
attatccatgcatgttaattaatcttacaattaattaatgtagaaagaacccacgtattctttatttgcggtaactacattacccatcaacaaaagatga |
52722226 |
T |
|
| Q |
101 |
atagaattatatatgttcagttgacaccaatcaaaactattttatatgtctttcacggtttatatta |
167 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
52722225 |
atagaattatatatattcagttgacaccaatcaaaactatttcatttgtcttttacggtttatatta |
52722159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 159 - 341
Target Start/End: Complemental strand, 52720596 - 52720410
Alignment:
| Q |
159 |
tttatattatagatatagtttatatagtgggcatatgaataattttgatcgatacgaactcaatatgggtaactctatccaccttttgttgatgggtagg |
258 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52720596 |
tttatattatatatatagtttatatagcgggcatatgaatgattttgattgatgcgaactcaatatgggtaactctatccacctttcgttgatgggtagg |
52720497 |
T |
|
| Q |
259 |
taataatttgctttcctttttaaattaatcctata----cggtgcttgttgatcctcatatcatcttgattaaattataaggaacct |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52720496 |
taataatttgctttcctttttaaattaatcctatacgcgcggtgcttgttgatcctcatatcatcttgattaaattataaggaacct |
52720410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University